Gene detail

Detail information of GWHGAAZE017360

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	CAN68925.1	1.2744E-91	hypothetical protein VITISV_044247 [Vitis vinifera]
Swissprot	tr\|F4IXJ7\|MED6_ARATH	4E-54	Mediator of RNA polymerase II transcription subunit 6
trEMBL	tr\|A5AE97\|A5AE97_VITVI	5E-92	Putative uncharacterized protein {ECO:0000313\|EMBL:CAN68925.1}
TAIR10	AT3G21350.1	4E-47	RNA polymerase transcriptional regulation mediator-related

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000005	gene	5077643	5080321	+
GWHAAZE00000005	mRNA	5077643	5080321	+
GWHAAZE00000005	exon	5077643	5077813	+
GWHAAZE00000005	exon	5078275	5078344	+
GWHAAZE00000005	exon	5079619	5079728	+
GWHAAZE00000005	exon	5080160	5080321	+
GWHAAZE00000005	CDS	5077643	5077813	+
GWHAAZE00000005	CDS	5078275	5078344	+
GWHAAZE00000005	CDS	5079619	5079728	+
GWHAAZE00000005	CDS	5080160	5080321	+

Transcript Sequence
>GWHTAAZE017380 ATGACAGGCACAGAATACACGCTGAGTGAAGTTATGGAGCCCCACCTGTTTGTCATCCGTAAACAAAAGAGAGATGGTCCTGAGAAAGTCACTCCAATGCTGACATATTATGTCTTGGATGGATCAATATACCAAGCACCACAGCTCTGCAATGTATTTGCAGCTCGAGTTGGAAGGGCTCTATATCATATATCAAAGGCGTTCAACACTACAGCCTCGAAGTTGGAGAAGATTGGATATGTTGATGCTGAAAATGAAAGTGCAGCCCTAGATACAAAGGTTGCTAAAGAGATGATCGACTTTAAGGAAGTTGTGCGAGTAGATCGCATTCTTGCTTCATTGCAACGCAAGCTTCCACCTGCGCCACCGCCGCCACCTTTCCCGGAAGGGTATGCACCCCCAGCAAGTGCTGAAGGAGAGACAGGAGGATCTGAAGGCCAGCAAGCCGATGCTCAACTTCCTGCCGTTGATCCCATTCTTGACCAGGGTCCTTCTAAGAGAATGAAATTTTAA

Network for GWHGAAZE017360

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF04934.15	Med6	1	73	1.30E-21

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	MED6

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0006357	biological_process	regulation of transcription by RNA polymerase II
GO:0016592	cellular_component	mediator complex
GO:0003712	molecular_function	transcription coregulator activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	45.927
	SRR3591706	second leaf	26.351
	SRR3591707	mature leaf	34.363
	SRR3591708	Shoot apex	53.668
	SRR3591709	Stem	58.353
	SRR3591710	White floral bud	36.945
	SRR3591711	White flower	40.647
	SRR3591712	Green floral bud	37.417
	SRR3591713	Yellow flower	34.734
SRP173429	SRR8316895	Juvenile bud stage	31.036
	SRR8316896	Juvenile bud stage	37.478
	SRR8316897	Juvenile bud stage	16.489
	SRR8316894	Third green stage	15.051
	SRR8316900	Third green stage	38.608
	SRR8316901	Third green stage	35.088
	SRR8316898	Complete white stage	12.728
	SRR8316899	Complete white stage	54.393
	SRR8316903	Complete white stage	21.763
	SRR8316902	Silver flowering stage	11.811
	SRR8316904	Silver flowering stage	16.726
	SRR8316905	Silver flowering stage	8.544
	SRR8316906	Gold flowering stage	29.171
	SRR8316907	Gold flowering stage	25.262
	SRR8316908	Gold flowering stage	28.286
SRP132670	SRR6706286	Control	30.036
	SRR6706287	Light intensity 50%	27.829
	SRR6706288	Light intensity 20%	31.655
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	54.192
	CNS0095593	Slightly white alabastrum(diploid) 2	47.971
	CNS0095594	Slightly white alabastrum(diploid) 3	47.606
	CNS0095595	Whole white alabastrum(diploid) 2	47.043
	CNS0095596	Whole white alabastrum(diploid) 3	39.086
	CNS0095597	Whole white alabastrum(diploid) 4	38.772
	CNS0095598	Silvery flower (diploied) 1	47.723
	CNS0095599	Silvery flower (diploied) 2	48.391
	CNS0095600	Silvery flower (diploied) 3	37.503
	CNS0095601	Golden flower (diploid) 1	41.493
	CNS0095602	Golden flower (diploid) 2	43.215
	CNS0095603	Golden flower (diploid) 3	40.338
	CNS0095604	Slightly white alabastrum(tetraploid) 1	45.793
	CNS0095605	Slightly white alabastrum(tetraploid) 2	44.840
	CNS0095606	Slightly white alabastrum(tetraploid) 3	54.419
	CNS0095607	Whole white alabastrum(tetraploid) 1	33.894
	CNS0095608	Whole white alabastrum(tetraploid) 2	31.687
	CNS0095609	Whole white alabastrum(tetraploid) 3	36.180
	CNS0095610	Silvery flower (tetraploid) 1	37.808
	CNS0095611	Silvery flower (tetraploid) 2	42.751
	CNS0095612	Silvery flower (tetraploid) 3	41.588
	CNS0095613	Golden flower (tetraploid) 1	32.490
	CNS0095614	Golden flower (tetraploid) 2	39.457
	CNS0095615	Golden flower (tetraploid) 3	32.471
CRA001975	CRR073297	Stem 1	34.041
	CRR073298	Stem 2	30.483
	CRR073299	Stem 3	33.613
	CRR073300	Leaf 1	28.925
	CRR073301	Leaf 2	29.306
	CRR073302	Leaf 3	26.422
	CRR073303	Juvenile bud 1	32.861
	CRR073304	Juvenile bud 2	20.636
	CRR073305	Juvenile bud 3	33.544
	CRR073306	Third green 1	6.921
	CRR073307	Third green 2	6.805
	CRR073308	Third green 3	12.195
	CRR073309	Second white 1	15.118
	CRR073310	Second white 2	12.655
	CRR073311	Second white 3	7.233
	CRR073312	Silver flowering 1	10.737
	CRR073313	Silver flowering 2	10.344
	CRR073314	Silver flowering 3	8.241
	CRR073315	Gold flowering 1	20.440
	CRR073316	Gold flowering 2	22.626
	CRR073317	Gold flowering 3	27.233
	CRR073318	Tawny withering 1	40.647
	CRR073319	Tawny withering 2	46.760
	CRR073320	Tawny withering 3	39.948