Gene detail

Detail information of GWHGAAZE017409

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_010033868.1	2.4118E-145	PREDICTED: ras-related protein Rab7-like [Eucalyptus grandis]
Swissprot	tr\|O24461\|RAB7_PRUAR	1E-143	Ras-related protein Rab7
trEMBL	tr\|A0A059AI28\|A0A059AI28_EUCGR	9E-146	Uncharacterized protein {ECO:0000313\|EMBL:KCW53702.1}
TAIR10	AT1G52280.1	4E-111	RAB GTPase homolog G3D

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000005	gene	5884932	5887281	-
GWHAAZE00000005	mRNA	5884932	5887281	-
GWHAAZE00000005	exon	5884932	5885001	-
GWHAAZE00000005	exon	5885490	5885635	-
GWHAAZE00000005	exon	5885741	5885821	-
GWHAAZE00000005	exon	5885994	5886140	-
GWHAAZE00000005	exon	5886804	5886903	-
GWHAAZE00000005	exon	5887010	5887036	-
GWHAAZE00000005	exon	5887229	5887281	-
GWHAAZE00000005	CDS	5887229	5887281	-
GWHAAZE00000005	CDS	5887010	5887036	-
GWHAAZE00000005	CDS	5886804	5886903	-
GWHAAZE00000005	CDS	5885994	5886140	-
GWHAAZE00000005	CDS	5885741	5885821	-
GWHAAZE00000005	CDS	5885490	5885635	-
GWHAAZE00000005	CDS	5884932	5885001	-

Transcript Sequence
>GWHTAAZE017429 ATGGCTTCTCGAAGGCGGATGCTTCTCAAGGTCATAATCCTTGGAGACAGTGGGGTTGGGAAGACATCTCTGATGAATCAGTATGTGAATCGTAAATTTAGTAATCAGTACAAAGCAACCATTGGAGCTGATTTCTTAACAAAAGAAGTTCAGTATGAAGACAGGTTGTTCACCTTGCAGATATGGGATACTGCAGGCCAAGAAAGATTCCAAAGCCTTGGTGTGGCTTTTTACCGTGGTGCAGACTGCTGCGTTCTTGTGTATGATGTGAACGTTGCTAAATCATTCGACGATCTCAACAACTGGCGTGAAGAGTTTCTAATTCAGGCTGGCCCATCAGATCCTGAGAACTTTCCATTTGTTGTATTGGGTAACAAAGTTGATATTGATGGTGGCAATAGTCGAGTTGTTTCTGAGAAGAAAGCAAGGGCATGGTGTGCCTCCAAGGGAAACATTCCTTACTTTGAGACTTCTGCAAAAGAAGGATTTAATGTGGAAGCTGCCTTCGAGTGTATAGTGAAAAATGCTCTCAAGAATGAACCTGAAGAAGAACCATATCTTCCCGATACCATTGATGTCGCTGGTGGAGGACATCAGCAAAGATCAACAGGATGCGAATGTTGA

Network for GWHGAAZE017409

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00071.23	Ras	10	177	1.00E-54

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K07897	RAB7A	Endocytosis	map04144
		Phagosome	map04145
		Autophagy - animal	map04140
		Autophagy - yeast	map04138
		Mitophagy - animal	map04137

Gene Ontology

GO term	Ontology	Name
GO:0005525	molecular_function	GTP binding
GO:0003924	molecular_function	GTPase activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	64.391
	SRR3591706	second leaf	47.910
	SRR3591707	mature leaf	53.165
	SRR3591708	Shoot apex	54.331
	SRR3591709	Stem	72.617
	SRR3591710	White floral bud	110.718
	SRR3591711	White flower	88.137
	SRR3591712	Green floral bud	68.482
	SRR3591713	Yellow flower	106.851
SRP173429	SRR8316895	Juvenile bud stage	31.856
	SRR8316896	Juvenile bud stage	45.648
	SRR8316897	Juvenile bud stage	18.265
	SRR8316894	Third green stage	17.613
	SRR8316900	Third green stage	56.265
	SRR8316901	Third green stage	60.175
	SRR8316898	Complete white stage	41.576
	SRR8316899	Complete white stage	99.014
	SRR8316903	Complete white stage	67.422
	SRR8316902	Silver flowering stage	49.519
	SRR8316904	Silver flowering stage	58.801
	SRR8316905	Silver flowering stage	35.793
	SRR8316906	Gold flowering stage	107.510
	SRR8316907	Gold flowering stage	102.366
	SRR8316908	Gold flowering stage	119.396
SRP132670	SRR6706286	Control	32.791
	SRR6706287	Light intensity 50%	33.553
	SRR6706288	Light intensity 20%	43.116
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	48.222
	CNS0095593	Slightly white alabastrum(diploid) 2	46.506
	CNS0095594	Slightly white alabastrum(diploid) 3	48.267
	CNS0095595	Whole white alabastrum(diploid) 2	43.745
	CNS0095596	Whole white alabastrum(diploid) 3	38.879
	CNS0095597	Whole white alabastrum(diploid) 4	46.499
	CNS0095598	Silvery flower (diploied) 1	64.109
	CNS0095599	Silvery flower (diploied) 2	56.499
	CNS0095600	Silvery flower (diploied) 3	68.547
	CNS0095601	Golden flower (diploid) 1	48.238
	CNS0095602	Golden flower (diploid) 2	68.051
	CNS0095603	Golden flower (diploid) 3	65.129
	CNS0095604	Slightly white alabastrum(tetraploid) 1	48.121
	CNS0095605	Slightly white alabastrum(tetraploid) 2	46.400
	CNS0095606	Slightly white alabastrum(tetraploid) 3	57.595
	CNS0095607	Whole white alabastrum(tetraploid) 1	41.536
	CNS0095608	Whole white alabastrum(tetraploid) 2	45.584
	CNS0095609	Whole white alabastrum(tetraploid) 3	50.407
	CNS0095610	Silvery flower (tetraploid) 1	88.705
	CNS0095611	Silvery flower (tetraploid) 2	86.184
	CNS0095612	Silvery flower (tetraploid) 3	98.223
	CNS0095613	Golden flower (tetraploid) 1	113.852
	CNS0095614	Golden flower (tetraploid) 2	84.629
	CNS0095615	Golden flower (tetraploid) 3	128.512
CRA001975	CRR073297	Stem 1	45.920
	CRR073298	Stem 2	45.724
	CRR073299	Stem 3	35.211
	CRR073300	Leaf 1	40.400
	CRR073301	Leaf 2	44.575
	CRR073302	Leaf 3	58.625
	CRR073303	Juvenile bud 1	59.241
	CRR073304	Juvenile bud 2	48.679
	CRR073305	Juvenile bud 3	41.748
	CRR073306	Third green 1	63.014
	CRR073307	Third green 2	84.154
	CRR073308	Third green 3	71.601
	CRR073309	Second white 1	53.481
	CRR073310	Second white 2	73.988
	CRR073311	Second white 3	45.400
	CRR073312	Silver flowering 1	33.165
	CRR073313	Silver flowering 2	27.869
	CRR073314	Silver flowering 3	26.272
	CRR073315	Gold flowering 1	47.452
	CRR073316	Gold flowering 2	63.575
	CRR073317	Gold flowering 3	35.184
	CRR073318	Tawny withering 1	51.779
	CRR073319	Tawny withering 2	54.321
	CRR073320	Tawny withering 3	58.852