Gene detail

Detail information of GWHGAAZE017492

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	CDO98141.1	1.66825E-88	unnamed protein product [Coffea canephora]
Swissprot	tr\|Q9SSR1\|Y1259_ARATH	2E-81	DCC family protein At1g52590, chloroplastic (Precursor)
trEMBL	tr\|A0A068TPG6\|A0A068TPG6_COFCA	6E-89	Coffea canephora DH200=94 genomic scaffold, scaffold_2 {ECO:0000313\|EMBL:CDO98141.1}
TAIR10	AT1G52590.1	5E-52	Putative thiol-disulphide oxidoreductase DCC

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000005	gene	7015361	7017621	+
GWHAAZE00000005	mRNA	7015361	7017621	+
GWHAAZE00000005	exon	7015361	7015562	+
GWHAAZE00000005	exon	7016351	7016408	+
GWHAAZE00000005	exon	7017078	7017185	+
GWHAAZE00000005	exon	7017351	7017443	+
GWHAAZE00000005	exon	7017537	7017621	+
GWHAAZE00000005	CDS	7015361	7015562	+
GWHAAZE00000005	CDS	7016351	7016408	+
GWHAAZE00000005	CDS	7017078	7017185	+
GWHAAZE00000005	CDS	7017351	7017443	+
GWHAAZE00000005	CDS	7017537	7017621	+

Transcript Sequence
>GWHTAAZE017512 ATGGCGTTGTCCACGGTTCCTGCTGGGTGCGCACGACTGAGCGTGCCACCGCCCCCCCGGCAAGCCAGACGCAGCCACCGAGTCCTCACTTTCGCCACTCTATCATCATCTCTTTCACGGGGAGGGAAAGCTGTTGACTTGGCATATACTACTACATCCACCTTCTTCCAACAAGATTCAAGGCCCATCATGCTCTTCGACGGTGTATGCAACTTGTGTAATGGAGGTGTGAAGTTTGTCCGTGATAATGATAGACAAAGGAGAATAAGGTTTGAATCTCTACAGAGCGAAGCAGGCAAGAAATTACTATTGAAATCTGGAAGGGCTCCTGATGATATTTCAAGCGTTGTACTTGTTGAAAAGGATAGGTCATATATCAAGTCAGAAGCTGTATTGAAGATCATGGAGTACATAGACTTACCATTCCCCCAGTTAGCATTCTTTTTACAGTTCGTGCCTCTATTCGTTCGGGATTTTGTATATGAAAACATTGCAAACAACCGCTACACCTTTTTCGGTCGCTCAGACTCATGTGAGATAGAATAA

Network for GWHGAAZE017492

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation
CFinderModule0274

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF04134.13	DUF393	65	174	4.00E-28

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	23.100
	SRR3591706	second leaf	46.987
	SRR3591707	mature leaf	89.924
	SRR3591708	Shoot apex	23.057
	SRR3591709	Stem	22.944
	SRR3591710	White floral bud	51.099
	SRR3591711	White flower	73.959
	SRR3591712	Green floral bud	25.277
	SRR3591713	Yellow flower	80.375
SRP173429	SRR8316895	Juvenile bud stage	12.449
	SRR8316896	Juvenile bud stage	17.111
	SRR8316897	Juvenile bud stage	14.147
	SRR8316894	Third green stage	6.225
	SRR8316900	Third green stage	23.635
	SRR8316901	Third green stage	28.514
	SRR8316898	Complete white stage	20.300
	SRR8316899	Complete white stage	36.672
	SRR8316903	Complete white stage	26.371
	SRR8316902	Silver flowering stage	26.037
	SRR8316904	Silver flowering stage	22.518
	SRR8316905	Silver flowering stage	15.275
	SRR8316906	Gold flowering stage	61.745
	SRR8316907	Gold flowering stage	55.712
	SRR8316908	Gold flowering stage	54.919
SRP132670	SRR6706286	Control	25.568
	SRR6706287	Light intensity 50%	25.685
	SRR6706288	Light intensity 20%	25.507
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	14.714
	CNS0095593	Slightly white alabastrum(diploid) 2	11.616
	CNS0095594	Slightly white alabastrum(diploid) 3	13.169
	CNS0095595	Whole white alabastrum(diploid) 2	16.339
	CNS0095596	Whole white alabastrum(diploid) 3	19.098
	CNS0095597	Whole white alabastrum(diploid) 4	13.653
	CNS0095598	Silvery flower (diploied) 1	26.852
	CNS0095599	Silvery flower (diploied) 2	31.889
	CNS0095600	Silvery flower (diploied) 3	58.810
	CNS0095601	Golden flower (diploid) 1	36.021
	CNS0095602	Golden flower (diploid) 2	56.166
	CNS0095603	Golden flower (diploid) 3	52.944
	CNS0095604	Slightly white alabastrum(tetraploid) 1	15.827
	CNS0095605	Slightly white alabastrum(tetraploid) 2	14.130
	CNS0095606	Slightly white alabastrum(tetraploid) 3	18.050
	CNS0095607	Whole white alabastrum(tetraploid) 1	13.319
	CNS0095608	Whole white alabastrum(tetraploid) 2	14.876
	CNS0095609	Whole white alabastrum(tetraploid) 3	24.949
	CNS0095610	Silvery flower (tetraploid) 1	108.444
	CNS0095611	Silvery flower (tetraploid) 2	118.264
	CNS0095612	Silvery flower (tetraploid) 3	106.591
	CNS0095613	Golden flower (tetraploid) 1	77.347
	CNS0095614	Golden flower (tetraploid) 2	83.226
	CNS0095615	Golden flower (tetraploid) 3	72.327
CRA001975	CRR073297	Stem 1	6.682
	CRR073298	Stem 2	5.026
	CRR073299	Stem 3	5.863
	CRR073300	Leaf 1	5.523
	CRR073301	Leaf 2	7.206
	CRR073302	Leaf 3	4.129
	CRR073303	Juvenile bud 1	9.530
	CRR073304	Juvenile bud 2	9.519
	CRR073305	Juvenile bud 3	5.211
	CRR073306	Third green 1	10.286
	CRR073307	Third green 2	7.456
	CRR073308	Third green 3	9.054
	CRR073309	Second white 1	14.812
	CRR073310	Second white 2	17.996
	CRR073311	Second white 3	15.660
	CRR073312	Silver flowering 1	12.892
	CRR073313	Silver flowering 2	15.593
	CRR073314	Silver flowering 3	12.287
	CRR073315	Gold flowering 1	39.195
	CRR073316	Gold flowering 2	32.793
	CRR073317	Gold flowering 3	19.968
	CRR073318	Tawny withering 1	5.284
	CRR073319	Tawny withering 2	4.745
	CRR073320	Tawny withering 3	4.307