Gene detail

Detail information of GWHGAAZE017504

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_010654789.1	2.08425E-69	PREDICTED: 26.5 kDa heat shock protein, mitochondrial [Vitis vinifera]
Swissprot	tr\|Q9SSQ8\|HS26M_ARATH	1E-52	26.5 kDa heat shock protein, mitochondrial (Precursor)
trEMBL	tr\|D7U122\|D7U122_VITVI	8E-70	Putative uncharacterized protein {ECO:0000313\|EMBL:CBI36318.3}
TAIR10	AT1G52560.2	1E-33	HSP20-like chaperones superfamily protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000005	gene	7115409	7116144	+
GWHAAZE00000005	mRNA	7115409	7116144	+
GWHAAZE00000005	exon	7115409	7115643	+
GWHAAZE00000005	exon	7115753	7116144	+
GWHAAZE00000005	five_prime_UTR	7115409	7115501	+
GWHAAZE00000005	CDS	7115502	7115643	+
GWHAAZE00000005	CDS	7115753	7116144	+

Transcript Sequence
>GWHTAAZE017524 CTTTGGTCTCTAAAACCCAAATTCTCAGTTACGCAAGTACGAGGGATCCGTAATTTTCAGAAACAGAAATGGAGCTTTGAGCTCCCCAAGAGAATGCTCTCCGCAAGAGCCACTGATGAGAAATCGGAGATTGCTGTCTCCGAGGGTGACAAGAAATCAAAGCTGTTTCCAAGAAGGAATCGCGACAGAGGTGGTCTCTTGCGGAACAATCTCAATTTAGTCCCTTCTCTCTCTGGGCTTGGAAATGCATTGATGCAAGCAACCCACAACATCAACAAGTTGTTTGAGAATTTATCGCCTTCGAGACTAATAGGAAGAGTCAAGGAGAAGGAGGATCACTACAAACTGAGGTATGAAGTGCCAGGGCTGGCGAAAGAGGATGTGAAAATCAGGGTGGAAGATGGAGTATTGCGCATAATAGGAGAGGCAAAGAATGAGGAGGAAGAGGAATCCGATGATGACTGTTGGTCTTCTTTGAGCTATGGCTACTATGATTCTGCTTTGGTGCTACCTGTGGATGCAAAGGTTGATGAAATTAAAGCAGAATTGAAGGATGGTGTGCTGTATATCACCATTCCTAGGATTGAAAAGGTGAAGAAAGATGTGAAGGAGGTCCAAGTTCTGTGA

Network for GWHGAAZE017504

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00011.22	HSP20	76	176	5.90E-25

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K13993	HSP20	Protein processing in endoplasmic reticulum	map04141

Gene Ontology

GO term	Ontology	Name

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	9.716
	SRR3591706	second leaf	2.392
	SRR3591707	mature leaf	1.151
	SRR3591708	Shoot apex	3.300
	SRR3591709	Stem	14.143
	SRR3591710	White floral bud	2.116
	SRR3591711	White flower	1.103
	SRR3591712	Green floral bud	1.218
	SRR3591713	Yellow flower	1.028
SRP173429	SRR8316895	Juvenile bud stage	2.642
	SRR8316896	Juvenile bud stage	23.907
	SRR8316897	Juvenile bud stage	2.422
	SRR8316894	Third green stage	0.609
	SRR8316900	Third green stage	2.176
	SRR8316901	Third green stage	2.816
	SRR8316898	Complete white stage	0.280
	SRR8316899	Complete white stage	1.866
	SRR8316903	Complete white stage	0.744
	SRR8316902	Silver flowering stage	0.448
	SRR8316904	Silver flowering stage	0.219
	SRR8316905	Silver flowering stage	0.092
	SRR8316906	Gold flowering stage	0.058
	SRR8316907	Gold flowering stage	0.595
	SRR8316908	Gold flowering stage	0.143
SRP132670	SRR6706286	Control	1.638
	SRR6706287	Light intensity 50%	1.488
	SRR6706288	Light intensity 20%	1.590
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	2.969
	CNS0095593	Slightly white alabastrum(diploid) 2	5.313
	CNS0095594	Slightly white alabastrum(diploid) 3	3.994
	CNS0095595	Whole white alabastrum(diploid) 2	3.078
	CNS0095596	Whole white alabastrum(diploid) 3	1.078
	CNS0095597	Whole white alabastrum(diploid) 4	2.759
	CNS0095598	Silvery flower (diploied) 1	2.440
	CNS0095599	Silvery flower (diploied) 2	35.008
	CNS0095600	Silvery flower (diploied) 3	7.277
	CNS0095601	Golden flower (diploid) 1	119.808
	CNS0095602	Golden flower (diploid) 2	12.734
	CNS0095603	Golden flower (diploid) 3	11.405
	CNS0095604	Slightly white alabastrum(tetraploid) 1	2.755
	CNS0095605	Slightly white alabastrum(tetraploid) 2	4.006
	CNS0095606	Slightly white alabastrum(tetraploid) 3	2.888
	CNS0095607	Whole white alabastrum(tetraploid) 1	1.688
	CNS0095608	Whole white alabastrum(tetraploid) 2	1.180
	CNS0095609	Whole white alabastrum(tetraploid) 3	1.382
	CNS0095610	Silvery flower (tetraploid) 1	1.199
	CNS0095611	Silvery flower (tetraploid) 2	0.945
	CNS0095612	Silvery flower (tetraploid) 3	0.289
	CNS0095613	Golden flower (tetraploid) 1	0.174
	CNS0095614	Golden flower (tetraploid) 2	0.215
	CNS0095615	Golden flower (tetraploid) 3	0.188
CRA001975	CRR073297	Stem 1	3.751
	CRR073298	Stem 2	3.844
	CRR073299	Stem 3	6.082
	CRR073300	Leaf 1	2.811
	CRR073301	Leaf 2	4.773
	CRR073302	Leaf 3	4.924
	CRR073303	Juvenile bud 1	2.325
	CRR073304	Juvenile bud 2	0.686
	CRR073305	Juvenile bud 3	2.904
	CRR073306	Third green 1	0.000
	CRR073307	Third green 2	0.064
	CRR073308	Third green 3	1.432
	CRR073309	Second white 1	0.074
	CRR073310	Second white 2	0.412
	CRR073311	Second white 3	0.362
	CRR073312	Silver flowering 1	0.246
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.205
	CRR073315	Gold flowering 1	11.743
	CRR073316	Gold flowering 2	9.377
	CRR073317	Gold flowering 3	9.356
	CRR073318	Tawny withering 1	21.293
	CRR073319	Tawny withering 2	11.487
	CRR073320	Tawny withering 3	26.009