Gene detail

Detail information of GWHGAAZE017561

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	CDO98221.1	1.52058E-87	unnamed protein product [Coffea canephora]
Swissprot	tr\|Q9XHS0\|RS12_HORVU	9E-74	40S ribosomal protein S12
trEMBL	tr\|A0A068TPS8\|A0A068TPS8_COFCA	6E-88	40S ribosomal protein S12 {ECO:0000256\|RuleBase:RU000670}
TAIR10	AT2G32060.3	1E-48	Ribosomal protein L7Ae/L30e/S12e/Gadd45 family protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000005	gene	7987173	7988568	+
GWHAAZE00000005	mRNA	7987173	7988568	+
GWHAAZE00000005	exon	7987173	7987180	+
GWHAAZE00000005	exon	7987796	7988087	+
GWHAAZE00000005	exon	7988344	7988409	+
GWHAAZE00000005	exon	7988509	7988568	+
GWHAAZE00000005	CDS	7987173	7987180	+
GWHAAZE00000005	CDS	7987796	7988087	+
GWHAAZE00000005	CDS	7988344	7988409	+
GWHAAZE00000005	CDS	7988509	7988568	+

Transcript Sequence
>GWHTAAZE017581 ATGGATGGTGAAGAGGCTGTTGTAGCGGTGGAGGCTGCACCAGCTCCAGCTCTGGGTGAGCCCATGGACATAATGACAGCCTTGCAGCTTGTGCTGAGGAAATCACTTGCTCATGGAGGGCTTGCTCGAGGGCTCCACGAAGGTGCAAAGGTTATTGAGAAGCATGCTGGCCAGCTCTGTGTATTGGCTGAGGATTGCAACCAACCGGACTATGTTAAACTGGTTAAAGCTCTTTGTGCTGACCACAATGTTAGCTTGATTTCAGTTCCCAGTGCTAAGACTCTGGGAGAATGGGTTGGTTTGTGCAAGATTGATTCAGAAGGAAAGGCAAGGAAGGTTGTCGGTTGCTCTTGTGCTGTTGTGAAGGATTATGGGGAGGACACGGAAGGTCTCCACATTGTTCAGGAGTATGTGAAGTCTCACTGA

Network for GWHGAAZE017561

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF01248.27	Ribosomal_L7Ae	27	120	3.30E-26

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K02951	RP-S12e, RPS12	Ribosome	map03010

Gene Ontology

GO term	Ontology	Name
GO:0006412	biological_process	translation
GO:0005840	cellular_component	ribosome
GO:0003735	molecular_function	structural constituent of ribosome

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	14.361
	SRR3591706	second leaf	2.123
	SRR3591707	mature leaf	1.646
	SRR3591708	Shoot apex	12.218
	SRR3591709	Stem	12.299
	SRR3591710	White floral bud	14.671
	SRR3591711	White flower	14.196
	SRR3591712	Green floral bud	17.363
	SRR3591713	Yellow flower	6.387
SRP173429	SRR8316895	Juvenile bud stage	52.732
	SRR8316896	Juvenile bud stage	69.347
	SRR8316897	Juvenile bud stage	45.668
	SRR8316894	Third green stage	22.884
	SRR8316900	Third green stage	80.756
	SRR8316901	Third green stage	68.378
	SRR8316898	Complete white stage	23.968
	SRR8316899	Complete white stage	80.826
	SRR8316903	Complete white stage	38.133
	SRR8316902	Silver flowering stage	25.182
	SRR8316904	Silver flowering stage	25.339
	SRR8316905	Silver flowering stage	14.144
	SRR8316906	Gold flowering stage	29.030
	SRR8316907	Gold flowering stage	38.166
	SRR8316908	Gold flowering stage	43.734
SRP132670	SRR6706286	Control	75.610
	SRR6706287	Light intensity 50%	76.807
	SRR6706288	Light intensity 20%	86.717
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	85.232
	CNS0095593	Slightly white alabastrum(diploid) 2	91.754
	CNS0095594	Slightly white alabastrum(diploid) 3	92.418
	CNS0095595	Whole white alabastrum(diploid) 2	62.125
	CNS0095596	Whole white alabastrum(diploid) 3	71.454
	CNS0095597	Whole white alabastrum(diploid) 4	46.372
	CNS0095598	Silvery flower (diploied) 1	49.118
	CNS0095599	Silvery flower (diploied) 2	49.486
	CNS0095600	Silvery flower (diploied) 3	38.772
	CNS0095601	Golden flower (diploid) 1	35.877
	CNS0095602	Golden flower (diploid) 2	26.217
	CNS0095603	Golden flower (diploid) 3	24.153
	CNS0095604	Slightly white alabastrum(tetraploid) 1	82.181
	CNS0095605	Slightly white alabastrum(tetraploid) 2	80.851
	CNS0095606	Slightly white alabastrum(tetraploid) 3	89.018
	CNS0095607	Whole white alabastrum(tetraploid) 1	39.760
	CNS0095608	Whole white alabastrum(tetraploid) 2	40.106
	CNS0095609	Whole white alabastrum(tetraploid) 3	70.014
	CNS0095610	Silvery flower (tetraploid) 1	39.362
	CNS0095611	Silvery flower (tetraploid) 2	42.271
	CNS0095612	Silvery flower (tetraploid) 3	39.799
	CNS0095613	Golden flower (tetraploid) 1	24.889
	CNS0095614	Golden flower (tetraploid) 2	28.531
	CNS0095615	Golden flower (tetraploid) 3	15.764
CRA001975	CRR073297	Stem 1	85.651
	CRR073298	Stem 2	81.993
	CRR073299	Stem 3	95.946
	CRR073300	Leaf 1	86.542
	CRR073301	Leaf 2	84.435
	CRR073302	Leaf 3	120.373
	CRR073303	Juvenile bud 1	97.659
	CRR073304	Juvenile bud 2	56.544
	CRR073305	Juvenile bud 3	81.239
	CRR073306	Third green 1	55.401
	CRR073307	Third green 2	60.827
	CRR073308	Third green 3	54.810
	CRR073309	Second white 1	27.285
	CRR073310	Second white 2	24.835
	CRR073311	Second white 3	19.650
	CRR073312	Silver flowering 1	15.701
	CRR073313	Silver flowering 2	25.792
	CRR073314	Silver flowering 3	24.127
	CRR073315	Gold flowering 1	34.054
	CRR073316	Gold flowering 2	36.577
	CRR073317	Gold flowering 3	24.741
	CRR073318	Tawny withering 1	95.968
	CRR073319	Tawny withering 2	95.862
	CRR073320	Tawny withering 3	120.026