Gene detail

Detail information of GWHGAAZE017646

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	KDP22561.1	7.7846E-125	hypothetical protein JCGZ_26392 [Jatropha curcas]
Swissprot	tr\|Q9FI61\|UBC27_ARATH	1E-112	Ubiquitin-conjugating enzyme E2 27
trEMBL	tr\|A0A067JF67\|A0A067JF67_JATCU	3E-125	Uncharacterized protein {ECO:0000313\|EMBL:KDP22561.1}
TAIR10	AT5G50870.1	5E-89	ubiquitin-conjugating enzyme 27

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000005	gene	9140463	9143450	+
GWHAAZE00000005	mRNA	9140463	9143450	+
GWHAAZE00000005	exon	9140463	9140640	+
GWHAAZE00000005	exon	9141028	9141076	+
GWHAAZE00000005	exon	9142273	9142432	+
GWHAAZE00000005	exon	9142637	9142726	+
GWHAAZE00000005	exon	9143343	9143450	+
GWHAAZE00000005	CDS	9140463	9140640	+
GWHAAZE00000005	CDS	9141028	9141076	+
GWHAAZE00000005	CDS	9142273	9142432	+
GWHAAZE00000005	CDS	9142637	9142726	+
GWHAAZE00000005	CDS	9143343	9143450	+

Transcript Sequence
>GWHTAAZE017666 ATGGTGGACTTAGCTCGTGTACAGAAGGAGCTTCAAGAGTGTAATAGAGACATCAATGTCTCTGGTATAAGGGTTAACCCTAAGAGCGATAATCTAACTCATTTGTTTGGCGCAATTCCTGGCCCTATCGGCACTCCTTACGAAGGCGGCACTTTCAACATCGACATAGTTTTGCCCGATGGTTATCCTTTCGAGCCACCCAGAATGCAATTTGCGACAAAAGTATGGCATCCTAATATCAGTAGTCAAAGTGGTGCTATATGCCTGGATATCCTGAAGGACCAGTGGAGCCCGGCACTCACTCTAAAGACAGCACTTCTTTCCATACAAGCATTACTGTCTGCCCCTGAACCAGATGATCCACAGGATGCTGTCGTAGCACAACAGTATCTTAGAGATTATCAGACCTTTGCGGGCACAGCTCGTTATTGGACAGAAACTTTTGCTAAGGCATCATCTCGAGGGGTTGAGGAAAAGGTACAAAAGCTTGTGGAGATGGGATTTCCGGAAGCTTTGGTGAGGAGTATGTTGGAAAAAGTTGGTGGCGATGAAAACATGGCTCTTGAGAAGCTTTGCTCTGGCTAG

Network for GWHGAAZE017646

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00179.27	UQ_con	6	144	7.80E-43
PF00627.32	UBA	157	190	1.70E-05

Protein Sequence

Gene family

Gene family	subfamily
Ubiquitin Family	UBC

KEGG pathway

KO	Enzyme	pathway	mapID
K04649	HIP2, UBC1	Ubiquitin mediated proteolysis	map04120

Gene Ontology

GO term	Ontology	Name
GO:0005515	molecular_function	protein binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	47.580
	SRR3591706	second leaf	21.636
	SRR3591707	mature leaf	25.286
	SRR3591708	Shoot apex	39.454
	SRR3591709	Stem	53.870
	SRR3591710	White floral bud	56.978
	SRR3591711	White flower	61.898
	SRR3591712	Green floral bud	53.432
	SRR3591713	Yellow flower	57.713
SRP173429	SRR8316895	Juvenile bud stage	30.461
	SRR8316896	Juvenile bud stage	49.319
	SRR8316897	Juvenile bud stage	23.791
	SRR8316894	Third green stage	20.050
	SRR8316900	Third green stage	64.226
	SRR8316901	Third green stage	69.248
	SRR8316898	Complete white stage	35.247
	SRR8316899	Complete white stage	88.643
	SRR8316903	Complete white stage	42.581
	SRR8316902	Silver flowering stage	29.864
	SRR8316904	Silver flowering stage	39.054
	SRR8316905	Silver flowering stage	19.616
	SRR8316906	Gold flowering stage	66.941
	SRR8316907	Gold flowering stage	76.690
	SRR8316908	Gold flowering stage	78.865
SRP132670	SRR6706286	Control	68.115
	SRR6706287	Light intensity 50%	69.765
	SRR6706288	Light intensity 20%	76.908
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	53.793
	CNS0095593	Slightly white alabastrum(diploid) 2	51.868
	CNS0095594	Slightly white alabastrum(diploid) 3	57.514
	CNS0095595	Whole white alabastrum(diploid) 2	51.302
	CNS0095596	Whole white alabastrum(diploid) 3	54.977
	CNS0095597	Whole white alabastrum(diploid) 4	60.317
	CNS0095598	Silvery flower (diploied) 1	37.766
	CNS0095599	Silvery flower (diploied) 2	51.875
	CNS0095600	Silvery flower (diploied) 3	68.541
	CNS0095601	Golden flower (diploid) 1	48.057
	CNS0095602	Golden flower (diploid) 2	58.509
	CNS0095603	Golden flower (diploid) 3	65.394
	CNS0095604	Slightly white alabastrum(tetraploid) 1	44.789
	CNS0095605	Slightly white alabastrum(tetraploid) 2	42.594
	CNS0095606	Slightly white alabastrum(tetraploid) 3	48.019
	CNS0095607	Whole white alabastrum(tetraploid) 1	51.864
	CNS0095608	Whole white alabastrum(tetraploid) 2	57.155
	CNS0095609	Whole white alabastrum(tetraploid) 3	54.173
	CNS0095610	Silvery flower (tetraploid) 1	66.141
	CNS0095611	Silvery flower (tetraploid) 2	68.109
	CNS0095612	Silvery flower (tetraploid) 3	66.000
	CNS0095613	Golden flower (tetraploid) 1	62.527
	CNS0095614	Golden flower (tetraploid) 2	60.500
	CNS0095615	Golden flower (tetraploid) 3	62.860
CRA001975	CRR073297	Stem 1	49.297
	CRR073298	Stem 2	54.289
	CRR073299	Stem 3	51.202
	CRR073300	Leaf 1	59.723
	CRR073301	Leaf 2	55.977
	CRR073302	Leaf 3	56.554
	CRR073303	Juvenile bud 1	58.791
	CRR073304	Juvenile bud 2	51.048
	CRR073305	Juvenile bud 3	49.684
	CRR073306	Third green 1	37.059
	CRR073307	Third green 2	49.918
	CRR073308	Third green 3	35.033
	CRR073309	Second white 1	67.974
	CRR073310	Second white 2	46.866
	CRR073311	Second white 3	37.286
	CRR073312	Silver flowering 1	42.982
	CRR073313	Silver flowering 2	49.572
	CRR073314	Silver flowering 3	36.164
	CRR073315	Gold flowering 1	56.407
	CRR073316	Gold flowering 2	63.994
	CRR073317	Gold flowering 3	66.931
	CRR073318	Tawny withering 1	54.482
	CRR073319	Tawny withering 2	53.732
	CRR073320	Tawny withering 3	43.341