Gene detail

Detail information of GWHGAAZE017652

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	CDP14991.1	5.07085E-63	unnamed protein product [Coffea canephora]
Swissprot	tr\|Q8H4S4\|NAC10_ORYSJ	3E-38	NAC transcription factor ONAC010
trEMBL	tr\|A0A068V2V0\|A0A068V2V0_COFCA	2E-63	Coffea canephora DH200=94 genomic scaffold, scaffold_94 {ECO:0000313\|EMBL:CDP14991.1}
TAIR10	AT5G13180.1	2E-45	NAC domain containing protein 83

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000005	gene	9199474	9200174	-
GWHAAZE00000005	mRNA	9199474	9200174	-
GWHAAZE00000005	exon	9199994	9200174	-
GWHAAZE00000005	exon	9199474	9199736	-
GWHAAZE00000005	CDS	9199994	9200174	-
GWHAAZE00000005	CDS	9199474	9199736	-

Transcript Sequence
>GWHTAAZE017672 ATGGAGAAACTGAATTTTGTTAAAGATGGAATAGTTAAATTGCCACCTGGCTTCCGTTTTCAGCCCACGGATGAAGAGATTGTGTTCCAGTACTTGACCCGTAAAATATTTTCCTTCCCTCTTCCTGCGTCCATTATTCCCGAGATCAACATTTCCCAATACAATCCTTGGGATTTACCAGGAGAATGGGAAGAGGACAGATACTTCTTTAACTACAAGAAGGAAGGCAATTACAAGAATGAAAGCAGAAGTAACAGAGCAAGTGGTTGTGGTTATTGGAAGGCTACTGGCTTGGACAAAAAAATAATTACAAGTCCAAGGAAGAAACAAGATGAGATAATAATGGGAATGAGGAAGACATTTGTTTTTCACAAAGGCAAGAATGGGTGTAGAACCAACTGGATGATGCATGAATATCGCCTCCTTCGCACACAAAATGCACAG

Network for GWHGAAZE017652

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF02365.16	NAM	15	141	5.30E-31

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	NAC

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0006355	biological_process	regulation of transcription, DNA-templated
GO:0003677	molecular_function	DNA binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	56.823
	SRR3591706	second leaf	9.177
	SRR3591707	mature leaf	0.000
	SRR3591708	Shoot apex	15.403
	SRR3591709	Stem	41.311
	SRR3591710	White floral bud	36.757
	SRR3591711	White flower	20.854
	SRR3591712	Green floral bud	20.439
	SRR3591713	Yellow flower	1.019
SRP173429	SRR8316895	Juvenile bud stage	3.309
	SRR8316896	Juvenile bud stage	4.041
	SRR8316897	Juvenile bud stage	0.977
	SRR8316894	Third green stage	2.276
	SRR8316900	Third green stage	10.705
	SRR8316901	Third green stage	6.943
	SRR8316898	Complete white stage	17.374
	SRR8316899	Complete white stage	12.705
	SRR8316903	Complete white stage	29.267
	SRR8316902	Silver flowering stage	33.975
	SRR8316904	Silver flowering stage	19.901
	SRR8316905	Silver flowering stage	0.764
	SRR8316906	Gold flowering stage	0.000
	SRR8316907	Gold flowering stage	7.618
	SRR8316908	Gold flowering stage	0.479
SRP132670	SRR6706286	Control	7.459
	SRR6706287	Light intensity 50%	6.328
	SRR6706288	Light intensity 20%	7.069
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	7.600
	CNS0095593	Slightly white alabastrum(diploid) 2	9.714
	CNS0095594	Slightly white alabastrum(diploid) 3	5.048
	CNS0095595	Whole white alabastrum(diploid) 2	8.501
	CNS0095596	Whole white alabastrum(diploid) 3	8.904
	CNS0095597	Whole white alabastrum(diploid) 4	5.669
	CNS0095598	Silvery flower (diploied) 1	0.159
	CNS0095599	Silvery flower (diploied) 2	0.377
	CNS0095600	Silvery flower (diploied) 3	8.473
	CNS0095601	Golden flower (diploid) 1	0.000
	CNS0095602	Golden flower (diploid) 2	0.161
	CNS0095603	Golden flower (diploid) 3	0.472
	CNS0095604	Slightly white alabastrum(tetraploid) 1	7.523
	CNS0095605	Slightly white alabastrum(tetraploid) 2	9.593
	CNS0095606	Slightly white alabastrum(tetraploid) 3	9.342
	CNS0095607	Whole white alabastrum(tetraploid) 1	3.491
	CNS0095608	Whole white alabastrum(tetraploid) 2	1.395
	CNS0095609	Whole white alabastrum(tetraploid) 3	6.714
	CNS0095610	Silvery flower (tetraploid) 1	13.554
	CNS0095611	Silvery flower (tetraploid) 2	4.002
	CNS0095612	Silvery flower (tetraploid) 3	1.601
	CNS0095613	Golden flower (tetraploid) 1	0.340
	CNS0095614	Golden flower (tetraploid) 2	2.397
	CNS0095615	Golden flower (tetraploid) 3	1.667
CRA001975	CRR073297	Stem 1	0.283
	CRR073298	Stem 2	0.784
	CRR073299	Stem 3	0.461
	CRR073300	Leaf 1	0.912
	CRR073301	Leaf 2	1.831
	CRR073302	Leaf 3	0.444
	CRR073303	Juvenile bud 1	0.443
	CRR073304	Juvenile bud 2	0.643
	CRR073305	Juvenile bud 3	0.630
	CRR073306	Third green 1	0.722
	CRR073307	Third green 2	1.244
	CRR073308	Third green 3	1.796
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.000
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	0.052
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	0.000
	CRR073316	Gold flowering 2	0.000
	CRR073317	Gold flowering 3	0.000
	CRR073318	Tawny withering 1	0.102
	CRR073319	Tawny withering 2	0.940
	CRR073320	Tawny withering 3	1.331