Gene detail

Detail information of GWHGAAZE017658

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_010533431.1	1.1296E-110	PREDICTED: putative 4-hydroxy-4-methyl-2-oxoglutarate aldolase 2 [Tarenaya hassleriana]
Swissprot	tr\|Q9FFE0\|RRAA2_ARATH	2E-103	Putative 4-hydroxy-4-methyl-2-oxoglutarate aldolase 2
trEMBL	tr\|A0A068TPU4\|A0A068TPU4_COFCA	2E-110	4-hydroxy-4-methyl-2-oxoglutarate aldolase {ECO:0000256\|RuleBase:RU004338}
TAIR10	AT5G16450.2	2E-81	Ribonuclease E inhibitor RraA/Dimethylmenaquinone methyltransferase

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000005	gene	9267379	9267879	-
GWHAAZE00000005	mRNA	9267379	9267879	-
GWHAAZE00000005	exon	9267379	9267879	-
GWHAAZE00000005	CDS	9267379	9267879	-

Transcript Sequence
>GWHTAAZE017678 ATGGCTTTGGTTACAACTGCTGAAGTTTGTGATTCAAACCCGCAACTCATTGTGAGCGGTGAGCTCCGTGCTCTCCAGCCAATTTTCCAGATATACGGAAGGCGCCAAGTCTTCTCGGGGCCGATAGTTACCCTCAAACTATTTGAAGACAATGGATTGGTTCGTTCGTTTCTCGAGGAGAAAGGTAATGGAAGAGTACTGGTTATCGATGGTGGTGGAAGCTTGAGATGTGCAGTTTTGGGTGGCAATCCTGTAGTTCAAGCGCAGAATAATGGGTGGGCTGGTATAGTGGTCAATGGCTGTATAAGAGACGTTGACGAAATAAACGGCTGTGATATTGGGGTGAGAGCTCTTTCTTCTCATCCAATGAAAGCTAATAAGAAGGGTATTGGGGAGAAGCATGTGCCTATAATCATTGCTGGGACTAGAATCTGTGATGGTGAATGGCTTTATGCGGATACTGATGGGATTTTGGTTTCAAGAACAGAGCTCTCTGTTTGA

Network for GWHGAAZE017658

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation
CFinderModule0188

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF03737.16	RraA-like	6	159	8.00E-42

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0051252	biological_process	regulation of RNA metabolic process
GO:0008428	molecular_function	ribonuclease inhibitor activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	44.923
	SRR3591706	second leaf	62.987
	SRR3591707	mature leaf	69.514
	SRR3591708	Shoot apex	86.815
	SRR3591709	Stem	49.455
	SRR3591710	White floral bud	44.401
	SRR3591711	White flower	54.960
	SRR3591712	Green floral bud	79.005
	SRR3591713	Yellow flower	28.749
SRP173429	SRR8316895	Juvenile bud stage	41.555
	SRR8316896	Juvenile bud stage	51.290
	SRR8316897	Juvenile bud stage	33.391
	SRR8316894	Third green stage	21.990
	SRR8316900	Third green stage	73.496
	SRR8316901	Third green stage	86.404
	SRR8316898	Complete white stage	22.565
	SRR8316899	Complete white stage	112.936
	SRR8316903	Complete white stage	34.370
	SRR8316902	Silver flowering stage	8.843
	SRR8316904	Silver flowering stage	12.213
	SRR8316905	Silver flowering stage	7.999
	SRR8316906	Gold flowering stage	22.445
	SRR8316907	Gold flowering stage	20.777
	SRR8316908	Gold flowering stage	24.587
SRP132670	SRR6706286	Control	120.397
	SRR6706287	Light intensity 50%	111.910
	SRR6706288	Light intensity 20%	115.872
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	66.232
	CNS0095593	Slightly white alabastrum(diploid) 2	62.769
	CNS0095594	Slightly white alabastrum(diploid) 3	58.968
	CNS0095595	Whole white alabastrum(diploid) 2	62.970
	CNS0095596	Whole white alabastrum(diploid) 3	57.947
	CNS0095597	Whole white alabastrum(diploid) 4	57.421
	CNS0095598	Silvery flower (diploied) 1	84.856
	CNS0095599	Silvery flower (diploied) 2	84.651
	CNS0095600	Silvery flower (diploied) 3	51.519
	CNS0095601	Golden flower (diploid) 1	83.371
	CNS0095602	Golden flower (diploid) 2	69.709
	CNS0095603	Golden flower (diploid) 3	67.815
	CNS0095604	Slightly white alabastrum(tetraploid) 1	65.062
	CNS0095605	Slightly white alabastrum(tetraploid) 2	60.171
	CNS0095606	Slightly white alabastrum(tetraploid) 3	113.288
	CNS0095607	Whole white alabastrum(tetraploid) 1	62.093
	CNS0095608	Whole white alabastrum(tetraploid) 2	50.605
	CNS0095609	Whole white alabastrum(tetraploid) 3	80.102
	CNS0095610	Silvery flower (tetraploid) 1	77.919
	CNS0095611	Silvery flower (tetraploid) 2	90.159
	CNS0095612	Silvery flower (tetraploid) 3	33.666
	CNS0095613	Golden flower (tetraploid) 1	50.028
	CNS0095614	Golden flower (tetraploid) 2	60.770
	CNS0095615	Golden flower (tetraploid) 3	15.203
CRA001975	CRR073297	Stem 1	50.242
	CRR073298	Stem 2	49.869
	CRR073299	Stem 3	46.922
	CRR073300	Leaf 1	65.561
	CRR073301	Leaf 2	65.696
	CRR073302	Leaf 3	58.122
	CRR073303	Juvenile bud 1	65.228
	CRR073304	Juvenile bud 2	46.734
	CRR073305	Juvenile bud 3	64.996
	CRR073306	Third green 1	2.634
	CRR073307	Third green 2	3.613
	CRR073308	Third green 3	5.181
	CRR073309	Second white 1	7.690
	CRR073310	Second white 2	6.596
	CRR073311	Second white 3	3.398
	CRR073312	Silver flowering 1	1.335
	CRR073313	Silver flowering 2	2.537
	CRR073314	Silver flowering 3	2.560
	CRR073315	Gold flowering 1	59.776
	CRR073316	Gold flowering 2	48.556
	CRR073317	Gold flowering 3	58.498
	CRR073318	Tawny withering 1	46.954
	CRR073319	Tawny withering 2	47.700
	CRR073320	Tawny withering 3	39.766