Gene detail

Detail information of GWHGAAZE017673

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_007038016.1	1.61795E-62	Skp2-like, FIST C domain, FIST domain, N-terminal isoform 2 [Theobroma cacao]
Swissprot	tr\|Q9FMV0\|FBL91_ARATH	1E-41	F-box/LRR-repeat protein At5g63520
trEMBL	tr\|A0A061G011\|A0A061G011_THECC	6E-63	Skp2-like, FIST C domain, FIST domain, N-terminal isoform 2 {ECO:0000313\|EMBL:EOY22517.1}
TAIR10	AT5G63520.1	2E-36	Without detailed annotation

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000005	gene	9482149	9483155	+
GWHAAZE00000005	mRNA	9482149	9483155	+
GWHAAZE00000005	exon	9482149	9482475	+
GWHAAZE00000005	exon	9482588	9482695	+
GWHAAZE00000005	exon	9482812	9482904	+
GWHAAZE00000005	exon	9483015	9483155	+
GWHAAZE00000005	CDS	9482149	9482475	+
GWHAAZE00000005	CDS	9482588	9482695	+
GWHAAZE00000005	CDS	9482812	9482904	+
GWHAAZE00000005	CDS	9483015	9483155	+

Transcript Sequence
>GWHTAAZE017693 CTAAGGATTGAGTTCGCAGCTATGGAGGAGGAACAGAGATCATCATCATCATCATCATCATCATCATTGCCATTGCTATTGAAATTCAACAACAAGAAGGAAAAAACAATAATAAGACACAGTCAACAATTGACAGGAGGAGGAGGAGGAGGTGGGAGTAGTATCGATCTGATAGGAGAAGACCTTCTTCACAACATACTCTCCAGGCTCCCTGCTCTATCCTTCGCCTCTGCCTCCTGCGTTAGCCGCGCCTGGAACCTTGTCTGCGACCGTCTCCTCTCTCGTCCCAAGCTCCTCTCTGCTCTCTCTCTTAACCCTTCTCTCCAGGGTGCGCTGTCAGAGGTTTTTCATAAGGTTTTATCTGAACCTATCCGTCCCCATTTCGCCATTGCCTCCATTGGTCGCTCTTTTAGCTTGCAAGACGCTCATCACCTCATTGCCACGAAACTCGGTTCAACAACACCACTCGTTACTACTGTGCCTCATGGAATTATAGGAAGGGATGCTCTTACAAATGAATTCAAAGAGATTCAGTGGGAAATAACCGAGGAAGAGTATCCTTCTGATTCTTTCATCCAACCCCCAAATACAAACCGAGCAATTGTGTTGACCGTAGGGTACCTACCAGGCTTGAAAGTTGATGCAATCCCCCTGTGGCATTCAAATGAG

Network for GWHGAAZE017673

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00646.34	F-box	58	97	2.90E-06

Protein Sequence

Gene family

Gene family	subfamily
Ubiquitin Family	F-box

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0005515	molecular_function	protein binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	13.805
	SRR3591706	second leaf	9.534
	SRR3591707	mature leaf	8.725
	SRR3591708	Shoot apex	12.422
	SRR3591709	Stem	7.903
	SRR3591710	White floral bud	23.383
	SRR3591711	White flower	11.970
	SRR3591712	Green floral bud	20.359
	SRR3591713	Yellow flower	13.792
SRP173429	SRR8316895	Juvenile bud stage	11.545
	SRR8316896	Juvenile bud stage	15.355
	SRR8316897	Juvenile bud stage	7.900
	SRR8316894	Third green stage	7.536
	SRR8316900	Third green stage	17.075
	SRR8316901	Third green stage	15.741
	SRR8316898	Complete white stage	4.383
	SRR8316899	Complete white stage	17.365
	SRR8316903	Complete white stage	10.627
	SRR8316902	Silver flowering stage	5.430
	SRR8316904	Silver flowering stage	9.455
	SRR8316905	Silver flowering stage	3.913
	SRR8316906	Gold flowering stage	12.457
	SRR8316907	Gold flowering stage	10.899
	SRR8316908	Gold flowering stage	9.964
SRP132670	SRR6706286	Control	33.095
	SRR6706287	Light intensity 50%	29.286
	SRR6706288	Light intensity 20%	28.749
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	9.380
	CNS0095593	Slightly white alabastrum(diploid) 2	11.467
	CNS0095594	Slightly white alabastrum(diploid) 3	9.980
	CNS0095595	Whole white alabastrum(diploid) 2	16.223
	CNS0095596	Whole white alabastrum(diploid) 3	15.616
	CNS0095597	Whole white alabastrum(diploid) 4	15.178
	CNS0095598	Silvery flower (diploied) 1	15.036
	CNS0095599	Silvery flower (diploied) 2	11.049
	CNS0095600	Silvery flower (diploied) 3	15.449
	CNS0095601	Golden flower (diploid) 1	13.310
	CNS0095602	Golden flower (diploid) 2	15.589
	CNS0095603	Golden flower (diploid) 3	18.140
	CNS0095604	Slightly white alabastrum(tetraploid) 1	15.805
	CNS0095605	Slightly white alabastrum(tetraploid) 2	9.769
	CNS0095606	Slightly white alabastrum(tetraploid) 3	15.320
	CNS0095607	Whole white alabastrum(tetraploid) 1	15.520
	CNS0095608	Whole white alabastrum(tetraploid) 2	9.526
	CNS0095609	Whole white alabastrum(tetraploid) 3	13.070
	CNS0095610	Silvery flower (tetraploid) 1	14.944
	CNS0095611	Silvery flower (tetraploid) 2	22.208
	CNS0095612	Silvery flower (tetraploid) 3	11.971
	CNS0095613	Golden flower (tetraploid) 1	7.402
	CNS0095614	Golden flower (tetraploid) 2	14.344
	CNS0095615	Golden flower (tetraploid) 3	15.824
CRA001975	CRR073297	Stem 1	29.843
	CRR073298	Stem 2	25.167
	CRR073299	Stem 3	24.711
	CRR073300	Leaf 1	33.540
	CRR073301	Leaf 2	29.326
	CRR073302	Leaf 3	26.607
	CRR073303	Juvenile bud 1	20.797
	CRR073304	Juvenile bud 2	17.332
	CRR073305	Juvenile bud 3	28.766
	CRR073306	Third green 1	7.939
	CRR073307	Third green 2	7.458
	CRR073308	Third green 3	8.934
	CRR073309	Second white 1	6.648
	CRR073310	Second white 2	5.603
	CRR073311	Second white 3	9.741
	CRR073312	Silver flowering 1	5.059
	CRR073313	Silver flowering 2	10.216
	CRR073314	Silver flowering 3	10.307
	CRR073315	Gold flowering 1	9.250
	CRR073316	Gold flowering 2	14.942
	CRR073317	Gold flowering 3	9.942
	CRR073318	Tawny withering 1	17.114
	CRR073319	Tawny withering 2	11.315
	CRR073320	Tawny withering 3	16.492