Gene detail

Detail information of GWHGAAZE017684

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_006436837.1	2.90205E-79	hypothetical protein CICLE_v10032657mg [Citrus clementina]
trEMBL	tr\|A0A067E0A7\|A0A067E0A7_CITSI	1E-79	Uncharacterized protein {ECO:0000313\|EMBL:KDO47290.1}
TAIR10	AT3G48540.1	2E-61	Cytidine/deoxycytidylate deaminase family protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000005	gene	9618310	9621086	+
GWHAAZE00000005	mRNA	9618310	9621086	+
GWHAAZE00000005	exon	9618310	9618384	+
GWHAAZE00000005	exon	9619209	9619248	+
GWHAAZE00000005	exon	9619850	9619901	+
GWHAAZE00000005	exon	9620362	9620425	+
GWHAAZE00000005	exon	9620774	9620827	+
GWHAAZE00000005	exon	9620976	9621086	+
GWHAAZE00000005	CDS	9618310	9618384	+
GWHAAZE00000005	CDS	9619209	9619248	+
GWHAAZE00000005	CDS	9619850	9619901	+
GWHAAZE00000005	CDS	9620362	9620425	+
GWHAAZE00000005	CDS	9620774	9620827	+
GWHAAZE00000005	CDS	9620976	9621086	+

Transcript Sequence
>GWHTAAZE017704 TATTTGTCTTGGGATGACTATTTTATGGCAATTGCATTTCTATCTGCTGAGCGTTCCAAGGATCCTAACAGGCAGGTTGGTGCATGCCTGGTGAGTCAAGATGGTATAATACTCGGCATTGGCTATAATGGATTTCCGCGTGGCTGTTCAGATGACAAGCTACCTTGTTATGTTTGTCATGCTGAAGTCAATGCTATCCTGAACACAAATCATGCATCAGCTGCAGGGCAGAGGCTTTACGTTACAATGTATCCTTGCAATGAATGTGCCAAGATAATTATTCAGTCTGGTGTTTCTGAAGTTATCTACTTTGTGGAGAAGAGGTTGTCAGAAACTCCGTATATTGCTTCTTGCAAGCTTCTATCAATGGCAGGTGTTAAAGTAAGCTATAGTTAA

Network for GWHGAAZE017684

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00383.24	dCMP_cyt_deam_1	3	104	6.00E-26

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K01493	comEB	Metabolic pathways	map01100
K01493	comEB	Pyrimidine metabolism	map00240

Gene Ontology

GO term	Ontology	Name
GO:0006220	biological_process	pyrimidine nucleotide metabolic process
GO:0003824	molecular_function	catalytic activity
GO:0004132	molecular_function	dCMP deaminase activity
GO:0008270	molecular_function	zinc ion binding
GO:0016787	molecular_function	hydrolase activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	7.627
	SRR3591706	second leaf	4.163
	SRR3591707	mature leaf	2.931
	SRR3591708	Shoot apex	8.466
	SRR3591709	Stem	2.250
	SRR3591710	White floral bud	2.664
	SRR3591711	White flower	1.978
	SRR3591712	Green floral bud	4.738
	SRR3591713	Yellow flower	1.368
SRP173429	SRR8316895	Juvenile bud stage	3.254
	SRR8316896	Juvenile bud stage	3.062
	SRR8316897	Juvenile bud stage	0.993
	SRR8316894	Third green stage	2.070
	SRR8316900	Third green stage	4.090
	SRR8316901	Third green stage	5.748
	SRR8316898	Complete white stage	0.514
	SRR8316899	Complete white stage	5.678
	SRR8316903	Complete white stage	1.378
	SRR8316902	Silver flowering stage	0.702
	SRR8316904	Silver flowering stage	0.286
	SRR8316905	Silver flowering stage	0.000
	SRR8316906	Gold flowering stage	0.464
	SRR8316907	Gold flowering stage	1.005
	SRR8316908	Gold flowering stage	1.067
SRP132670	SRR6706286	Control	2.312
	SRR6706287	Light intensity 50%	3.125
	SRR6706288	Light intensity 20%	3.241
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	6.609
	CNS0095593	Slightly white alabastrum(diploid) 2	5.151
	CNS0095594	Slightly white alabastrum(diploid) 3	3.591
	CNS0095595	Whole white alabastrum(diploid) 2	4.223
	CNS0095596	Whole white alabastrum(diploid) 3	3.388
	CNS0095597	Whole white alabastrum(diploid) 4	1.890
	CNS0095598	Silvery flower (diploied) 1	4.128
	CNS0095599	Silvery flower (diploied) 2	4.634
	CNS0095600	Silvery flower (diploied) 3	2.564
	CNS0095601	Golden flower (diploid) 1	2.406
	CNS0095602	Golden flower (diploid) 2	2.716
	CNS0095603	Golden flower (diploid) 3	2.628
	CNS0095604	Slightly white alabastrum(tetraploid) 1	5.967
	CNS0095605	Slightly white alabastrum(tetraploid) 2	3.999
	CNS0095606	Slightly white alabastrum(tetraploid) 3	6.027
	CNS0095607	Whole white alabastrum(tetraploid) 1	1.336
	CNS0095608	Whole white alabastrum(tetraploid) 2	2.471
	CNS0095609	Whole white alabastrum(tetraploid) 3	4.579
	CNS0095610	Silvery flower (tetraploid) 1	1.218
	CNS0095611	Silvery flower (tetraploid) 2	1.028
	CNS0095612	Silvery flower (tetraploid) 3	1.435
	CNS0095613	Golden flower (tetraploid) 1	0.731
	CNS0095614	Golden flower (tetraploid) 2	0.899
	CNS0095615	Golden flower (tetraploid) 3	0.000
CRA001975	CRR073297	Stem 1	3.903
	CRR073298	Stem 2	4.907
	CRR073299	Stem 3	6.193
	CRR073300	Leaf 1	7.222
	CRR073301	Leaf 2	3.942
	CRR073302	Leaf 3	3.635
	CRR073303	Juvenile bud 1	3.426
	CRR073304	Juvenile bud 2	2.848
	CRR073305	Juvenile bud 3	4.492
	CRR073306	Third green 1	0.034
	CRR073307	Third green 2	0.098
	CRR073308	Third green 3	0.600
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.148
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	0.138
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.122
	CRR073315	Gold flowering 1	1.987
	CRR073316	Gold flowering 2	3.879
	CRR073317	Gold flowering 3	2.349
	CRR073318	Tawny withering 1	2.657
	CRR073319	Tawny withering 2	3.679
	CRR073320	Tawny withering 3	6.110