Gene detail

Detail information of GWHGAAZE017732

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	CDP15082.1	9.7393E-138	unnamed protein product [Coffea canephora]
Swissprot	tr\|Q9FMK7\|BT1_ARATH	5E-106	BTB/POZ and TAZ domain-containing protein 1
trEMBL	tr\|A0A068V3E2\|A0A068V3E2_COFCA	4E-138	Coffea canephora DH200=94 genomic scaffold, scaffold_94 {ECO:0000313\|EMBL:CDP15082.1}
TAIR10	AT5G63160.1	1E-86	BTB and TAZ domain protein 1

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000005	gene	10162868	10164715	+
GWHAAZE00000005	mRNA	10162868	10164715	+
GWHAAZE00000005	exon	10162868	10162957	+
GWHAAZE00000005	exon	10163250	10163383	+
GWHAAZE00000005	exon	10163786	10164044	+
GWHAAZE00000005	exon	10164395	10164715	+
GWHAAZE00000005	CDS	10162868	10162957	+
GWHAAZE00000005	CDS	10163250	10163383	+
GWHAAZE00000005	CDS	10163786	10164044	+
GWHAAZE00000005	CDS	10164395	10164715	+

Transcript Sequence
>GWHTAAZE017752 TCCGATCAAATCTCCAGTGAAATGAACGAAGCCCCGGTTCAAATCGTCACTTCTGGTGGACAACGCATCCCCGCTCAAGCTAGCATCCTGTCCTCGGCTTCGCCAGTACTGGAGAGCATCATAGATAGGCCGGAGAAGCACCGGAGTTCCGAGAGAACCATTCCGATCCTCGGCGTACCTTGCGACGCCGTCTCCGTGTTCGTTCGATTTCTCTATTTGAAAAGTACTGTCACACGTGTACATGGTACCGCAGCTGAAGCAGAGTGTACCAGAGCACTGTCCGAGCGTTTAACGGTTGATAACGTGGTTGACGTCCTTCAACTTGCAAGGCTCTGCGATGCACCTGATCTTTACCTTAGGTGCATGAAACTAGCATGTACCAGTTTCAAGGCTGTTGAGAATACTGAAGGTTGGAAGTTCGTTCAAAATCACGACCCTTGGTTAGAATTGGAGATTCTTCGGTTCATTGACGAGGCTGAATCGAGGAAAAAAAGAACAAGGAAGCATAGAGAGGAACAGAGCTTATATTTGCTACTGAGCGAGGCTATGGAGTGTTTGGAGCATATATGTACGGAAGGATGTACAAATGTTGGGCCTCATGATATGGAGACTGCCAAGAATAAGGTACCATGCAGCAAATTCTCAACTTGTCAAGGCCTCCAGCTCTCCATTCGTCACTTTGCCATTTGTAAGCGGAGGGTTAATGGAGGTTGTTTAAGATGTAAGCGAATGTGGCAAATTTTGAGACTTCACTCTGCCATTTGCGACCAACCCGATATATGCAGAGTTCCCCTGTGCAGGTAA

Network for GWHGAAZE017732

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00651.32	BTB	13	128	1.10E-06
PF02135.17	zf-TAZ	180	266	8.40E-11

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	TAZ
Ubiquitin Family	3-box

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0006355	biological_process	regulation of transcription, DNA-templated
GO:0005634	cellular_component	nucleus
GO:0005515	molecular_function	protein binding
GO:0003712	molecular_function	transcription coregulator activity
GO:0004402	molecular_function	histone acetyltransferase activity
GO:0008270	molecular_function	zinc ion binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	11.985
	SRR3591706	second leaf	2.030
	SRR3591707	mature leaf	0.482
	SRR3591708	Shoot apex	5.173
	SRR3591709	Stem	5.921
	SRR3591710	White floral bud	4.231
	SRR3591711	White flower	20.999
	SRR3591712	Green floral bud	3.793
	SRR3591713	Yellow flower	37.078
SRP173429	SRR8316895	Juvenile bud stage	1.421
	SRR8316896	Juvenile bud stage	2.390
	SRR8316897	Juvenile bud stage	0.753
	SRR8316894	Third green stage	1.065
	SRR8316900	Third green stage	2.496
	SRR8316901	Third green stage	1.862
	SRR8316898	Complete white stage	1.521
	SRR8316899	Complete white stage	5.415
	SRR8316903	Complete white stage	5.866
	SRR8316902	Silver flowering stage	31.246
	SRR8316904	Silver flowering stage	36.534
	SRR8316905	Silver flowering stage	25.955
	SRR8316906	Gold flowering stage	150.629
	SRR8316907	Gold flowering stage	104.785
	SRR8316908	Gold flowering stage	171.165
SRP132670	SRR6706286	Control	1.979
	SRR6706287	Light intensity 50%	2.599
	SRR6706288	Light intensity 20%	1.921
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	2.519
	CNS0095593	Slightly white alabastrum(diploid) 2	2.703
	CNS0095594	Slightly white alabastrum(diploid) 3	1.849
	CNS0095595	Whole white alabastrum(diploid) 2	1.805
	CNS0095596	Whole white alabastrum(diploid) 3	0.158
	CNS0095597	Whole white alabastrum(diploid) 4	1.832
	CNS0095598	Silvery flower (diploied) 1	6.489
	CNS0095599	Silvery flower (diploied) 2	6.968
	CNS0095600	Silvery flower (diploied) 3	34.127
	CNS0095601	Golden flower (diploid) 1	12.637
	CNS0095602	Golden flower (diploid) 2	55.529
	CNS0095603	Golden flower (diploid) 3	54.001
	CNS0095604	Slightly white alabastrum(tetraploid) 1	2.870
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.469
	CNS0095606	Slightly white alabastrum(tetraploid) 3	13.746
	CNS0095607	Whole white alabastrum(tetraploid) 1	2.549
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.153
	CNS0095609	Whole white alabastrum(tetraploid) 3	1.014
	CNS0095610	Silvery flower (tetraploid) 1	27.732
	CNS0095611	Silvery flower (tetraploid) 2	23.958
	CNS0095612	Silvery flower (tetraploid) 3	21.643
	CNS0095613	Golden flower (tetraploid) 1	37.010
	CNS0095614	Golden flower (tetraploid) 2	29.737
	CNS0095615	Golden flower (tetraploid) 3	68.127
CRA001975	CRR073297	Stem 1	4.412
	CRR073298	Stem 2	4.071
	CRR073299	Stem 3	4.647
	CRR073300	Leaf 1	3.870
	CRR073301	Leaf 2	3.320
	CRR073302	Leaf 3	3.647
	CRR073303	Juvenile bud 1	1.515
	CRR073304	Juvenile bud 2	1.541
	CRR073305	Juvenile bud 3	2.794
	CRR073306	Third green 1	12.141
	CRR073307	Third green 2	14.924
	CRR073308	Third green 3	12.367
	CRR073309	Second white 1	64.802
	CRR073310	Second white 2	90.407
	CRR073311	Second white 3	89.043
	CRR073312	Silver flowering 1	151.959
	CRR073313	Silver flowering 2	144.683
	CRR073314	Silver flowering 3	165.057
	CRR073315	Gold flowering 1	0.938
	CRR073316	Gold flowering 2	1.907
	CRR073317	Gold flowering 3	0.634
	CRR073318	Tawny withering 1	7.003
	CRR073319	Tawny withering 2	10.382
	CRR073320	Tawny withering 3	12.263