Gene detail

Detail information of GWHGAAZE017765

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_007037499.1	3.1456E-61	C2H2-like zinc finger protein, putative [Theobroma cacao]
Swissprot	tr\|Q9SHD0\|ZAT4_ARATH	1E-28	Zinc finger protein ZAT4
trEMBL	tr\|A0A061FWS6\|A0A061FWS6_THECC	1E-61	C2H2-like zinc finger protein, putative {ECO:0000313\|EMBL:EOY22000.1}
TAIR10	AT2G45120.1	1E-23	C2H2-like zinc finger protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000005	gene	10571301	10571831	+
GWHAAZE00000005	mRNA	10571301	10571831	+
GWHAAZE00000005	exon	10571301	10571831	+
GWHAAZE00000005	CDS	10571301	10571831	+

Transcript Sequence
>GWHTAAZE017785 ATGTATGACAAGAAAAGAAAATTCCAGTGTACTACTTGCAACAAAGCCTTTCACTCTTATCAAGCACTTGGTGGCCACAGAGCAAGCCACAAGAAGCTCAAAGGCTGCTTTGCTTCCAAAATCAATGGCGACAAAAACACCACCACCACCGATGATCAGTTCTCATCAAATCCAACTACTGATAACTACAACGATCATCAAGAAATGGGCGTCAGTTCAAAGAAGGACAAATCGCATGAGTGCCCGATTTGCTTCAGAGTTTTCTCATCGGGGCAAGCATTAGGCGGTCACAAACGATCGCATTTAGTTGGGGCTACTGTCAATGAGGCCAAAAACAAACAAAGCAACCTTGTGATTGAGAAACCAATGCCAGAAACTAGGGATTTTATTGATCTTAATATGCCAGCACCCGTTGAAGAAGAGAGCAGTACTACTACTACTACTACTAATAGTGGGCGTGTTGGGTTCAAGCCATGGTGGTCTGAAAGAAACCACAAGCATGAGCCGCTTCTTGGTCTGCTCTCACAGTAA

Network for GWHGAAZE017765

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF13912.7	zf-C2H2_6	8	32	8.50E-11
PF13912.7	zf-C2H2_6	79	101	2.20E-10

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	C2H2

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0003676	molecular_function	nucleic acid binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.351
	SRR3591706	second leaf	0.259
	SRR3591707	mature leaf	1.464
	SRR3591708	Shoot apex	0.360
	SRR3591709	Stem	3.660
	SRR3591710	White floral bud	2.033
	SRR3591711	White flower	0.389
	SRR3591712	Green floral bud	3.073
	SRR3591713	Yellow flower	0.245
SRP173429	SRR8316895	Juvenile bud stage	0.450
	SRR8316896	Juvenile bud stage	0.508
	SRR8316897	Juvenile bud stage	0.563
	SRR8316894	Third green stage	0.886
	SRR8316900	Third green stage	0.928
	SRR8316901	Third green stage	0.725
	SRR8316898	Complete white stage	0.322
	SRR8316899	Complete white stage	1.698
	SRR8316903	Complete white stage	0.941
	SRR8316902	Silver flowering stage	0.193
	SRR8316904	Silver flowering stage	0.533
	SRR8316905	Silver flowering stage	0.152
	SRR8316906	Gold flowering stage	0.232
	SRR8316907	Gold flowering stage	0.064
	SRR8316908	Gold flowering stage	0.000
SRP132670	SRR6706286	Control	1.268
	SRR6706287	Light intensity 50%	1.084
	SRR6706288	Light intensity 20%	1.029
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	2.724
	CNS0095593	Slightly white alabastrum(diploid) 2	1.711
	CNS0095594	Slightly white alabastrum(diploid) 3	1.785
	CNS0095595	Whole white alabastrum(diploid) 2	1.288
	CNS0095596	Whole white alabastrum(diploid) 3	2.156
	CNS0095597	Whole white alabastrum(diploid) 4	2.916
	CNS0095598	Silvery flower (diploied) 1	0.237
	CNS0095599	Silvery flower (diploied) 2	1.393
	CNS0095600	Silvery flower (diploied) 3	0.219
	CNS0095601	Golden flower (diploid) 1	0.122
	CNS0095602	Golden flower (diploid) 2	0.215
	CNS0095603	Golden flower (diploid) 3	0.017
	CNS0095604	Slightly white alabastrum(tetraploid) 1	2.719
	CNS0095605	Slightly white alabastrum(tetraploid) 2	3.379
	CNS0095606	Slightly white alabastrum(tetraploid) 3	2.398
	CNS0095607	Whole white alabastrum(tetraploid) 1	2.629
	CNS0095608	Whole white alabastrum(tetraploid) 2	3.074
	CNS0095609	Whole white alabastrum(tetraploid) 3	1.744
	CNS0095610	Silvery flower (tetraploid) 1	0.783
	CNS0095611	Silvery flower (tetraploid) 2	0.223
	CNS0095612	Silvery flower (tetraploid) 3	0.463
	CNS0095613	Golden flower (tetraploid) 1	0.000
	CNS0095614	Golden flower (tetraploid) 2	0.423
	CNS0095615	Golden flower (tetraploid) 3	0.155
CRA001975	CRR073297	Stem 1	1.453
	CRR073298	Stem 2	1.411
	CRR073299	Stem 3	0.566
	CRR073300	Leaf 1	1.132
	CRR073301	Leaf 2	0.589
	CRR073302	Leaf 3	1.097
	CRR073303	Juvenile bud 1	0.493
	CRR073304	Juvenile bud 2	0.844
	CRR073305	Juvenile bud 3	1.657
	CRR073306	Third green 1	0.179
	CRR073307	Third green 2	0.298
	CRR073308	Third green 3	0.141
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.000
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	0.207
	CRR073316	Gold flowering 2	0.000
	CRR073317	Gold flowering 3	0.000
	CRR073318	Tawny withering 1	0.180
	CRR073319	Tawny withering 2	2.687
	CRR073320	Tawny withering 3	2.907