Gene detail

Detail information of GWHGAAZE017826

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_010092056.1	2.278E-101	hypothetical protein L484_005307 [Morus notabilis]
Swissprot	tr\|Q9S7V4\|HA22A_ARATH	2E-90	HVA22-like protein a
trEMBL	tr\|W9RBT9\|W9RBT9_9ROSA	8E-102	Uncharacterized protein {ECO:0000313\|EMBL:EXB49970.1}
TAIR10	AT1G74520.1	1E-71	HVA22 homologue A

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000005	gene	11270874	11273166	+
GWHAAZE00000005	mRNA	11270874	11273166	+
GWHAAZE00000005	exon	11270874	11270935	+
GWHAAZE00000005	exon	11271318	11271344	+
GWHAAZE00000005	exon	11271521	11271643	+
GWHAAZE00000005	exon	11272690	11272933	+
GWHAAZE00000005	exon	11273101	11273166	+
GWHAAZE00000005	CDS	11270874	11270935	+
GWHAAZE00000005	CDS	11271318	11271344	+
GWHAAZE00000005	CDS	11271521	11271643	+
GWHAAZE00000005	CDS	11272690	11272933	+
GWHAAZE00000005	CDS	11273101	11273166	+

Transcript Sequence
>GWHTAAZE017846 ATGGGATCTGGGGCTGGAACCTTCCTCAAAGTGCTCGCCCAGAACTTCGACATTCTTGCTGGGCCAGTGGTTAGTCTCCTCTATCCTCTGTATGCCTCAATCAGGGCAATTGAGACCAAGTCCCCTGTGGACGATCAACAATGGCTTACCTACTGGGTTCTTTATTCTATGATTACTCTTTTTGAGCTTACCTTCGCAAAGCTCCTCGAATGGATCCCATTCTGGTCATATGCGAAGCTGATTGTAACGTGCTGGTTGGTCATACCATACTTCAGTGGTGCTGCGTATGTTTATGAGCACTATGTTCGGCCTTTCTTTCTGAACAGACAGACTGTTAACATCTGGTATGTACCAAGGAAGAAGGATGTCTTCAGTAAACCAGATGACATCCTAACTGCTGCGGAGAAATACATGCAAGAAAATGGAACTGAAGCTTTTGAGAAGATGATTCATCGTGCTGACAAGGAAGTGAGATACAGGGGTAACAGCTACGTCTTTTCGGATGGGGACTATAGATATTGA

Network for GWHGAAZE017826

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation
CFinderModule0166

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF03134.20	TB2_DP1_HVA22	29	105	1.20E-26

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	131.643
	SRR3591706	second leaf	118.478
	SRR3591707	mature leaf	43.305
	SRR3591708	Shoot apex	118.368
	SRR3591709	Stem	112.473
	SRR3591710	White floral bud	34.813
	SRR3591711	White flower	23.589
	SRR3591712	Green floral bud	53.367
	SRR3591713	Yellow flower	4.544
SRP173429	SRR8316895	Juvenile bud stage	63.120
	SRR8316896	Juvenile bud stage	80.230
	SRR8316897	Juvenile bud stage	44.847
	SRR8316894	Third green stage	22.893
	SRR8316900	Third green stage	49.089
	SRR8316901	Third green stage	49.203
	SRR8316898	Complete white stage	6.598
	SRR8316899	Complete white stage	72.328
	SRR8316903	Complete white stage	13.166
	SRR8316902	Silver flowering stage	3.032
	SRR8316904	Silver flowering stage	3.000
	SRR8316905	Silver flowering stage	0.740
	SRR8316906	Gold flowering stage	5.338
	SRR8316907	Gold flowering stage	4.203
	SRR8316908	Gold flowering stage	8.855
SRP132670	SRR6706286	Control	33.029
	SRR6706287	Light intensity 50%	34.406
	SRR6706288	Light intensity 20%	39.392
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	68.546
	CNS0095593	Slightly white alabastrum(diploid) 2	84.897
	CNS0095594	Slightly white alabastrum(diploid) 3	61.155
	CNS0095595	Whole white alabastrum(diploid) 2	70.059
	CNS0095596	Whole white alabastrum(diploid) 3	34.583
	CNS0095597	Whole white alabastrum(diploid) 4	39.757
	CNS0095598	Silvery flower (diploied) 1	65.214
	CNS0095599	Silvery flower (diploied) 2	70.008
	CNS0095600	Silvery flower (diploied) 3	24.131
	CNS0095601	Golden flower (diploid) 1	59.580
	CNS0095602	Golden flower (diploid) 2	36.678
	CNS0095603	Golden flower (diploid) 3	38.414
	CNS0095604	Slightly white alabastrum(tetraploid) 1	53.288
	CNS0095605	Slightly white alabastrum(tetraploid) 2	46.825
	CNS0095606	Slightly white alabastrum(tetraploid) 3	88.017
	CNS0095607	Whole white alabastrum(tetraploid) 1	35.695
	CNS0095608	Whole white alabastrum(tetraploid) 2	25.250
	CNS0095609	Whole white alabastrum(tetraploid) 3	45.237
	CNS0095610	Silvery flower (tetraploid) 1	10.740
	CNS0095611	Silvery flower (tetraploid) 2	21.247
	CNS0095612	Silvery flower (tetraploid) 3	9.406
	CNS0095613	Golden flower (tetraploid) 1	3.342
	CNS0095614	Golden flower (tetraploid) 2	9.816
	CNS0095615	Golden flower (tetraploid) 3	1.927
CRA001975	CRR073297	Stem 1	71.562
	CRR073298	Stem 2	65.711
	CRR073299	Stem 3	79.191
	CRR073300	Leaf 1	53.829
	CRR073301	Leaf 2	61.298
	CRR073302	Leaf 3	66.468
	CRR073303	Juvenile bud 1	59.470
	CRR073304	Juvenile bud 2	32.463
	CRR073305	Juvenile bud 3	56.210
	CRR073306	Third green 1	2.208
	CRR073307	Third green 2	3.251
	CRR073308	Third green 3	5.622
	CRR073309	Second white 1	9.383
	CRR073310	Second white 2	2.210
	CRR073311	Second white 3	2.886
	CRR073312	Silver flowering 1	2.085
	CRR073313	Silver flowering 2	5.238
	CRR073314	Silver flowering 3	3.741
	CRR073315	Gold flowering 1	48.698
	CRR073316	Gold flowering 2	48.522
	CRR073317	Gold flowering 3	58.233
	CRR073318	Tawny withering 1	107.790
	CRR073319	Tawny withering 2	104.591
	CRR073320	Tawny withering 3	99.571