Gene detail

Detail information of GWHGAAZE017847

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_002321530.2	8.4819E-68	hypothetical protein POPTR_0015s07640g [Populus trichocarpa]
Swissprot	tr\|Q02283\|HAT5_ARATH	4E-41	Homeobox-leucine zipper protein HAT5
trEMBL	tr\|A9PHH0\|A9PHH0_POPTR	3E-68	Uncharacterized protein {ECO:0000313\|EMBL:EEF05657.2}
TAIR10	AT3G01470.1	2E-34	homeobox 1

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000005	gene	11606512	11606967	+
GWHAAZE00000005	mRNA	11606512	11606967	+
GWHAAZE00000005	exon	11606512	11606967	+
GWHAAZE00000005	CDS	11606512	11606967	+

Transcript Sequence
>GWHTAAZE017867 ATGGTTAGCTTTGAAGATGTCAATAGAAGATACAAATCAGACAATTCATTCTTTTGCTCATTCGATCGAGAAGATAATGGAGATGACGAATTGGATGAGTACTTTCATCAACCTGACAAGAAGAGACGTCTCAAGGCCGACCAAGTCCAATTTCTTGAAAAGAGTTTCGAAACAGAGAACAAGCTTGAACCCGAAAGGAAAGTTCAACTTGCAAAGGACCTTGGCTTGCAGCCTCGCCAGGTTGCAATATGGTTCCAAAACCGCCGGGCACGATGGAAGAATAAACAGCTGGAGAGAGATTACGATGTATTGCAATCTAGCTACAACAGCCTCAAGGCTGACTATGAAAACCTCCTCAAGGATAAGGACATACTAAAAGCTGAGGTATGGCCCACTCACTCTGTCTCTAGTAGTACACATATTGGACTGCAACGTGGTACATCCGTCCATCGGTGA

Network for GWHGAAZE017847

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00046.30	Homeodomain	40	94	2.80E-17
PF02183.19	HALZ	95	129	2.20E-14

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	HB-HD-ZIP

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0006355	biological_process	regulation of transcription, DNA-templated
GO:0003677	molecular_function	DNA binding
GO:0043565	molecular_function	sequence-specific DNA binding
GO:0003700	molecular_function	DNA-binding transcription factor activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	27.683
	SRR3591706	second leaf	16.666
	SRR3591707	mature leaf	67.832
	SRR3591708	Shoot apex	12.133
	SRR3591709	Stem	96.337
	SRR3591710	White floral bud	63.411
	SRR3591711	White flower	77.363
	SRR3591712	Green floral bud	43.963
	SRR3591713	Yellow flower	65.165
SRP173429	SRR8316895	Juvenile bud stage	9.415
	SRR8316896	Juvenile bud stage	11.836
	SRR8316897	Juvenile bud stage	5.594
	SRR8316894	Third green stage	8.118
	SRR8316900	Third green stage	17.954
	SRR8316901	Third green stage	15.709
	SRR8316898	Complete white stage	17.045
	SRR8316899	Complete white stage	33.734
	SRR8316903	Complete white stage	26.676
	SRR8316902	Silver flowering stage	24.611
	SRR8316904	Silver flowering stage	32.820
	SRR8316905	Silver flowering stage	18.880
	SRR8316906	Gold flowering stage	82.701
	SRR8316907	Gold flowering stage	54.896
	SRR8316908	Gold flowering stage	78.268
SRP132670	SRR6706286	Control	35.763
	SRR6706287	Light intensity 50%	28.723
	SRR6706288	Light intensity 20%	32.429
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	12.371
	CNS0095593	Slightly white alabastrum(diploid) 2	8.550
	CNS0095594	Slightly white alabastrum(diploid) 3	10.601
	CNS0095595	Whole white alabastrum(diploid) 2	9.381
	CNS0095596	Whole white alabastrum(diploid) 3	11.097
	CNS0095597	Whole white alabastrum(diploid) 4	11.113
	CNS0095598	Silvery flower (diploied) 1	14.728
	CNS0095599	Silvery flower (diploied) 2	15.115
	CNS0095600	Silvery flower (diploied) 3	45.367
	CNS0095601	Golden flower (diploid) 1	16.316
	CNS0095602	Golden flower (diploid) 2	39.503
	CNS0095603	Golden flower (diploid) 3	40.862
	CNS0095604	Slightly white alabastrum(tetraploid) 1	10.408
	CNS0095605	Slightly white alabastrum(tetraploid) 2	10.285
	CNS0095606	Slightly white alabastrum(tetraploid) 3	15.218
	CNS0095607	Whole white alabastrum(tetraploid) 1	7.495
	CNS0095608	Whole white alabastrum(tetraploid) 2	7.091
	CNS0095609	Whole white alabastrum(tetraploid) 3	17.107
	CNS0095610	Silvery flower (tetraploid) 1	42.687
	CNS0095611	Silvery flower (tetraploid) 2	36.640
	CNS0095612	Silvery flower (tetraploid) 3	51.155
	CNS0095613	Golden flower (tetraploid) 1	35.273
	CNS0095614	Golden flower (tetraploid) 2	55.415
	CNS0095615	Golden flower (tetraploid) 3	81.269
CRA001975	CRR073297	Stem 1	22.190
	CRR073298	Stem 2	21.823
	CRR073299	Stem 3	22.399
	CRR073300	Leaf 1	21.491
	CRR073301	Leaf 2	19.576
	CRR073302	Leaf 3	23.496
	CRR073303	Juvenile bud 1	22.153
	CRR073304	Juvenile bud 2	28.206
	CRR073305	Juvenile bud 3	21.267
	CRR073306	Third green 1	22.388
	CRR073307	Third green 2	20.938
	CRR073308	Third green 3	28.338
	CRR073309	Second white 1	34.995
	CRR073310	Second white 2	39.800
	CRR073311	Second white 3	36.440
	CRR073312	Silver flowering 1	38.280
	CRR073313	Silver flowering 2	32.733
	CRR073314	Silver flowering 3	32.999
	CRR073315	Gold flowering 1	30.565
	CRR073316	Gold flowering 2	37.636
	CRR073317	Gold flowering 3	24.839
	CRR073318	Tawny withering 1	55.931
	CRR073319	Tawny withering 2	78.349
	CRR073320	Tawny withering 3	71.547