Gene detail

Detail information of GWHGAAZE017883

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_002280390.1	5.62383E-88	PREDICTED: E3 ubiquitin-protein ligase TRAF7 [Vitis vinifera]
Swissprot	tr\|P25387\|GBLP_CHLRE	8E-11	Guanine nucleotide-binding protein subunit beta-like protein
trEMBL	tr\|F6GSV3\|F6GSV3_VITVI	2E-88	Putative uncharacterized protein {ECO:0000313\|EMBL:CCB43010.1}
TAIR10	AT5G50120.1	7E-53	Transducin/WD40 repeat-like superfamily protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000005	gene	12071861	12072373	+
GWHAAZE00000005	mRNA	12071861	12072373	+
GWHAAZE00000005	exon	12071861	12072373	+
GWHAAZE00000005	CDS	12071861	12072373	+

Transcript Sequence
>GWHTAAZE017903 ATGACATTATCATATGATGGGCATGTTTACACCGGATCAGCAGACAAGAAAATTAAGGTGTGGAGGAAAAGGTTAGGAGAAAAGAAGCATTCCCTAATTGCGACACTAGAAAAACATAACTCGGGGGTCAATGCACTGGCACTGAGCACCGATGGGTCCGTGTTGTACTCAGGTGCGCGTGACAGATCGATACTGGTTTGGGAGAAGGATGATGAAGGCAATATGCTGGTTGTGGGTGCACTTAGGGGGCATGCCAAGTCGATATTGTGCTTGGCCGTGGTGTCAGATTTGGTGTCTAGTGGTTCGGCGGATAAAACAGTGAGAATTTGGAGACGGGTTGATAATTGCTACTCTTGCTTAGCAATATTGGAAGGGCACCAAGGCCCGATTAAGTGCTTGACAATGGTTGGTGATCGTTATAATCCATCCGATTCAACCTCTTCATATCAAGTCTACAGTGGAAGTTTGGACTGTGACATCAAGATCTGGCAGATTTTTGTTCCTCTTCTTTAA

Network for GWHGAAZE017883

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation
CFinderModule0115

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00400.33	WD40	32	67	3.00E-05
PF00400.33	WD40	79	110	1.60E-05
PF00400.33	WD40	118	163	0.00013

Protein Sequence

Gene family

Gene family	subfamily
Ubiquitin Family	DWD

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0005515	molecular_function	protein binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	3.008
	SRR3591706	second leaf	0.414
	SRR3591707	mature leaf	0.653
	SRR3591708	Shoot apex	1.142
	SRR3591709	Stem	1.960
	SRR3591710	White floral bud	14.263
	SRR3591711	White flower	7.777
	SRR3591712	Green floral bud	5.157
	SRR3591713	Yellow flower	1.828
SRP173429	SRR8316895	Juvenile bud stage	2.883
	SRR8316896	Juvenile bud stage	2.591
	SRR8316897	Juvenile bud stage	1.459
	SRR8316894	Third green stage	2.685
	SRR8316900	Third green stage	5.506
	SRR8316901	Third green stage	4.611
	SRR8316898	Complete white stage	2.737
	SRR8316899	Complete white stage	24.149
	SRR8316903	Complete white stage	6.478
	SRR8316902	Silver flowering stage	2.391
	SRR8316904	Silver flowering stage	1.149
	SRR8316905	Silver flowering stage	0.549
	SRR8316906	Gold flowering stage	0.707
	SRR8316907	Gold flowering stage	0.760
	SRR8316908	Gold flowering stage	0.145
SRP132670	SRR6706286	Control	3.844
	SRR6706287	Light intensity 50%	3.772
	SRR6706288	Light intensity 20%	5.152
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	6.313
	CNS0095593	Slightly white alabastrum(diploid) 2	9.592
	CNS0095594	Slightly white alabastrum(diploid) 3	8.622
	CNS0095595	Whole white alabastrum(diploid) 2	6.572
	CNS0095596	Whole white alabastrum(diploid) 3	3.306
	CNS0095597	Whole white alabastrum(diploid) 4	7.148
	CNS0095598	Silvery flower (diploied) 1	9.924
	CNS0095599	Silvery flower (diploied) 2	8.273
	CNS0095600	Silvery flower (diploied) 3	6.576
	CNS0095601	Golden flower (diploid) 1	5.842
	CNS0095602	Golden flower (diploid) 2	3.744
	CNS0095603	Golden flower (diploid) 3	3.417
	CNS0095604	Slightly white alabastrum(tetraploid) 1	9.216
	CNS0095605	Slightly white alabastrum(tetraploid) 2	7.535
	CNS0095606	Slightly white alabastrum(tetraploid) 3	16.057
	CNS0095607	Whole white alabastrum(tetraploid) 1	12.591
	CNS0095608	Whole white alabastrum(tetraploid) 2	7.513
	CNS0095609	Whole white alabastrum(tetraploid) 3	1.146
	CNS0095610	Silvery flower (tetraploid) 1	2.483
	CNS0095611	Silvery flower (tetraploid) 2	5.940
	CNS0095612	Silvery flower (tetraploid) 3	3.048
	CNS0095613	Golden flower (tetraploid) 1	0.381
	CNS0095614	Golden flower (tetraploid) 2	1.568
	CNS0095615	Golden flower (tetraploid) 3	0.000
CRA001975	CRR073297	Stem 1	6.544
	CRR073298	Stem 2	5.989
	CRR073299	Stem 3	7.611
	CRR073300	Leaf 1	7.033
	CRR073301	Leaf 2	10.235
	CRR073302	Leaf 3	5.653
	CRR073303	Juvenile bud 1	7.188
	CRR073304	Juvenile bud 2	3.121
	CRR073305	Juvenile bud 3	13.695
	CRR073306	Third green 1	1.134
	CRR073307	Third green 2	0.579
	CRR073308	Third green 3	0.611
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.911
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	1.090
	CRR073316	Gold flowering 2	0.543
	CRR073317	Gold flowering 3	0.171
	CRR073318	Tawny withering 1	0.385
	CRR073319	Tawny withering 2	1.759
	CRR073320	Tawny withering 3	0.000