Gene detail

Detail information of GWHGAAZE017918

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_008239769.1	7.6909E-114	PREDICTED: dof zinc finger protein DOF5.6 [Prunus mume]
Swissprot	tr\|Q9FM03\|DOF56_ARATH	4E-46	Dof zinc finger protein DOF5.6
trEMBL	tr\|M5WDR0\|M5WDR0_PRUPE	1E-113	Uncharacterized protein {ECO:0000313\|EMBL:EMJ11426.1}
TAIR10	AT5G62940.1	2E-32	Dof-type zinc finger DNA-binding family protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000005	gene	12474617	12475420	+
GWHAAZE00000005	mRNA	12474617	12475420	+
GWHAAZE00000005	exon	12474617	12475420	+
GWHAAZE00000005	CDS	12474617	12475420	+

Transcript Sequence
>GWHTAAZE017938 ATGGATTCTTCGTCACCATCAGGGGGAGACATGCTAACATGCTCGAGGCCCTTAATAGAGAGGAGGCTAAGGCCCCCACACGACCAATCCCTAAAATGCCCCCGCTGTGAATCCACTCACACCAAATTTTGCTACTACAACAACTACAGCCTATCCCAGCCCCGTTACTTCTGCAAAACATGCCGCCGTTACTGGACCAAAGGTGGCACCCTCCGTAACATCCCTGTCGGCGGTGGCTGCCGTAAGAACAAAAAGGTCTCCTCAAAAAAATCCAACGACCCACCACCCATGATTACCCAAAACATCGGATCCTCCAATTCTCACAACCCGACCCAACTCCAACTCTCCAATTACCCCGACCCGGCCCAGTTCTCCCACCTTAATAATTTGGGCCTTAATAACCCAAACTTCTTGGACATGAAATATAATGCCATACCCATTGACTTCATGGAGACCAAGTTTGACTTTATGGGGAATGGCGGTGACTTGGGCATGATCGGTGGGCTTGGTGACATTAGCAATTCCCATGGGTTAGGGACTAGTTTTCACGGTACCAATCTTTGTTCCCAGTTTGGCATGTCGATTGACGGGAATAATGGAAATTTTAATTTTCCTTATGAAGGGAATGTGGAGCCAAGTGGGATTGATGTGAAGCCAAACAAATTATTGTCACTTGAGTGGCAAGACCAAGGTTGTTCTGATGCTGGCAAGGACTCTAATTTCGGATACTTTACTAATGGCCTCGGGTCGTGGACCGGGTTGATGAACGGGTATGGGTCGTCCGCAGCAAACCCGTTAGTCTAA

Network for GWHGAAZE017918

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF02701.16	zf-Dof	28	85	2.10E-33

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	C2C2-Dof

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0006355	biological_process	regulation of transcription, DNA-templated
GO:0003677	molecular_function	DNA binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	28.171
	SRR3591706	second leaf	18.541
	SRR3591707	mature leaf	2.967
	SRR3591708	Shoot apex	18.179
	SRR3591709	Stem	14.543
	SRR3591710	White floral bud	2.190
	SRR3591711	White flower	1.978
	SRR3591712	Green floral bud	8.584
	SRR3591713	Yellow flower	0.376
SRP173429	SRR8316895	Juvenile bud stage	9.164
	SRR8316896	Juvenile bud stage	10.091
	SRR8316897	Juvenile bud stage	3.849
	SRR8316894	Third green stage	3.988
	SRR8316900	Third green stage	1.845
	SRR8316901	Third green stage	4.691
	SRR8316898	Complete white stage	0.182
	SRR8316899	Complete white stage	2.306
	SRR8316903	Complete white stage	0.192
	SRR8316902	Silver flowering stage	0.087
	SRR8316904	Silver flowering stage	0.134
	SRR8316905	Silver flowering stage	0.000
	SRR8316906	Gold flowering stage	0.382
	SRR8316907	Gold flowering stage	0.175
	SRR8316908	Gold flowering stage	0.000
SRP132670	SRR6706286	Control	2.470
	SRR6706287	Light intensity 50%	1.855
	SRR6706288	Light intensity 20%	2.652
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	10.142
	CNS0095593	Slightly white alabastrum(diploid) 2	8.576
	CNS0095594	Slightly white alabastrum(diploid) 3	8.196
	CNS0095595	Whole white alabastrum(diploid) 2	2.861
	CNS0095596	Whole white alabastrum(diploid) 3	1.523
	CNS0095597	Whole white alabastrum(diploid) 4	1.678
	CNS0095598	Silvery flower (diploied) 1	2.276
	CNS0095599	Silvery flower (diploied) 2	3.569
	CNS0095600	Silvery flower (diploied) 3	0.553
	CNS0095601	Golden flower (diploid) 1	1.860
	CNS0095602	Golden flower (diploid) 2	1.373
	CNS0095603	Golden flower (diploid) 3	1.319
	CNS0095604	Slightly white alabastrum(tetraploid) 1	7.654
	CNS0095605	Slightly white alabastrum(tetraploid) 2	8.344
	CNS0095606	Slightly white alabastrum(tetraploid) 3	18.199
	CNS0095607	Whole white alabastrum(tetraploid) 1	2.791
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.540
	CNS0095609	Whole white alabastrum(tetraploid) 3	1.875
	CNS0095610	Silvery flower (tetraploid) 1	0.227
	CNS0095611	Silvery flower (tetraploid) 2	0.327
	CNS0095612	Silvery flower (tetraploid) 3	0.821
	CNS0095613	Golden flower (tetraploid) 1	0.306
	CNS0095614	Golden flower (tetraploid) 2	0.515
	CNS0095615	Golden flower (tetraploid) 3	0.775
CRA001975	CRR073297	Stem 1	9.894
	CRR073298	Stem 2	8.983
	CRR073299	Stem 3	13.862
	CRR073300	Leaf 1	4.491
	CRR073301	Leaf 2	4.766
	CRR073302	Leaf 3	4.202
	CRR073303	Juvenile bud 1	2.938
	CRR073304	Juvenile bud 2	2.007
	CRR073305	Juvenile bud 3	3.509
	CRR073306	Third green 1	0.175
	CRR073307	Third green 2	0.441
	CRR073308	Third green 3	0.146
	CRR073309	Second white 1	0.063
	CRR073310	Second white 2	0.225
	CRR073311	Second white 3	0.227
	CRR073312	Silver flowering 1	0.204
	CRR073313	Silver flowering 2	0.427
	CRR073314	Silver flowering 3	0.123
	CRR073315	Gold flowering 1	2.500
	CRR073316	Gold flowering 2	2.708
	CRR073317	Gold flowering 3	3.750
	CRR073318	Tawny withering 1	11.132
	CRR073319	Tawny withering 2	12.425
	CRR073320	Tawny withering 3	13.204