Gene detail

Detail information of GWHGAAZE017936

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_002282076.1	2.75286E-51	PREDICTED: homeobox protein knotted-1-like 6 [Vitis vinifera]
Swissprot	tr\|Q84JS6\|KNAT6_ARATH	3E-45	Homeobox protein knotted-1-like 6
trEMBL	tr\|D7SHP3\|D7SHP3_VITVI	1E-51	Putative uncharacterized protein {ECO:0000313\|EMBL:CBI15003.3}
TAIR10	AT1G23380.2	5E-36	KNOTTED1-like homeobox gene 6

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000005	gene	12629670	12630723	+
GWHAAZE00000005	mRNA	12629670	12630723	+
GWHAAZE00000005	exon	12629670	12629915	+
GWHAAZE00000005	exon	12630550	12630723	+
GWHAAZE00000005	CDS	12629670	12629915	+
GWHAAZE00000005	CDS	12630550	12630723	+

Transcript Sequence
>GWHTAAZE017958 ATGTACATAGCAAATGAAGGGTCATCTGAGGAGGAATTTAGTGCAGGGGAGACAGATGGGCAAGAATGTTACAGCGCAAGGGAAGATCAAGAGCTTAAGGATAACCTCTTGCGTAAATATAGTGGCTATATTAGTTCCTTGAAGCATGGCTTCTCAAATAAGAAGAAGAAAGGGAAGCTACCTAGAGAAGCAAGGGAAACCATGCTTGATTGGTGGTCGATTCACTACAAATGGCCATACCCAACGGAGGCAGACAAGAGGGCTCTAGCGGATTGGACGGGCTTAGATCAAAAGCAGATAAACAACTGGTTTATAAACCAAAGGAAACGTCACTGGAAGCCATCAGCAGCAGATCTGAACATGATGCCATTTGGTGTCACAGACAGTAGTACTATCTATGGATCATTCGATCTTCAATGA

Network for GWHGAAZE017936

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF03789.14	ELK	31	52	1.10E-09
PF05920.12	Homeobox_KN	71	110	2.40E-16

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	HB-other

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0006355	biological_process	regulation of transcription, DNA-templated
GO:0003677	molecular_function	DNA binding
GO:0043565	molecular_function	sequence-specific DNA binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	1.075
	SRR3591706	second leaf	0.000
	SRR3591707	mature leaf	0.000
	SRR3591708	Shoot apex	0.542
	SRR3591709	Stem	2.394
	SRR3591710	White floral bud	0.081
	SRR3591711	White flower	0.000
	SRR3591712	Green floral bud	0.027
	SRR3591713	Yellow flower	0.000
SRP173429	SRR8316895	Juvenile bud stage	1.007
	SRR8316896	Juvenile bud stage	1.360
	SRR8316897	Juvenile bud stage	0.421
	SRR8316894	Third green stage	0.000
	SRR8316900	Third green stage	0.000
	SRR8316901	Third green stage	0.022
	SRR8316898	Complete white stage	0.276
	SRR8316899	Complete white stage	0.177
	SRR8316903	Complete white stage	0.146
	SRR8316902	Silver flowering stage	0.000
	SRR8316904	Silver flowering stage	0.000
	SRR8316905	Silver flowering stage	0.075
	SRR8316906	Gold flowering stage	0.000
	SRR8316907	Gold flowering stage	0.000
	SRR8316908	Gold flowering stage	0.777
SRP132670	SRR6706286	Control	0.220
	SRR6706287	Light intensity 50%	0.106
	SRR6706288	Light intensity 20%	0.127
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.633
	CNS0095593	Slightly white alabastrum(diploid) 2	0.396
	CNS0095594	Slightly white alabastrum(diploid) 3	0.313
	CNS0095595	Whole white alabastrum(diploid) 2	0.105
	CNS0095596	Whole white alabastrum(diploid) 3	0.112
	CNS0095597	Whole white alabastrum(diploid) 4	0.327
	CNS0095598	Silvery flower (diploied) 1	0.000
	CNS0095599	Silvery flower (diploied) 2	0.209
	CNS0095600	Silvery flower (diploied) 3	0.387
	CNS0095601	Golden flower (diploid) 1	0.371
	CNS0095602	Golden flower (diploid) 2	0.242
	CNS0095603	Golden flower (diploid) 3	0.245
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.500
	CNS0095605	Slightly white alabastrum(tetraploid) 2	1.010
	CNS0095606	Slightly white alabastrum(tetraploid) 3	1.130
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.594
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.415
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.000
	CNS0095610	Silvery flower (tetraploid) 1	0.000
	CNS0095611	Silvery flower (tetraploid) 2	0.044
	CNS0095612	Silvery flower (tetraploid) 3	0.090
	CNS0095613	Golden flower (tetraploid) 1	0.000
	CNS0095614	Golden flower (tetraploid) 2	0.888
	CNS0095615	Golden flower (tetraploid) 3	0.000
CRA001975	CRR073297	Stem 1	0.150
	CRR073298	Stem 2	0.170
	CRR073299	Stem 3	0.133
	CRR073300	Leaf 1	0.000
	CRR073301	Leaf 2	0.623
	CRR073302	Leaf 3	0.000
	CRR073303	Juvenile bud 1	0.144
	CRR073304	Juvenile bud 2	0.000
	CRR073305	Juvenile bud 3	0.000
	CRR073306	Third green 1	0.000
	CRR073307	Third green 2	0.000
	CRR073308	Third green 3	0.000
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.000
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	0.000
	CRR073316	Gold flowering 2	0.000
	CRR073317	Gold flowering 3	0.000
	CRR073318	Tawny withering 1	3.665
	CRR073319	Tawny withering 2	5.840
	CRR073320	Tawny withering 3	4.749