Gene detail

Detail information of GWHGAAZE018029

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_006357409.1	9.82884E-14	PREDICTED: exocyst complex component 7-like isoform X1 [Solanum tuberosum]
Swissprot	tr\|Q9LZD3\|E70A1_ARATH	0.000000008	Exocyst complex component EXO70A1
trEMBL	tr\|M1A1D4\|M1A1D4_SOLTU	4E-14	Uncharacterized protein {ECO:0000313\|EnsemblPlants:PGSC0003DMT400012539}
TAIR10	AT1G72470.1	4E-13	exocyst subunit exo70 family protein D1

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000005	gene	13834471	13834773	+
GWHAAZE00000005	mRNA	13834471	13834773	+
GWHAAZE00000005	exon	13834471	13834773	+
GWHAAZE00000005	CDS	13834471	13834773	+

Transcript Sequence
>GWHTAAZE018051 ATGTTGCACTGTTTAAGGGATGATGCGCCACAACGGTTAGGCAAGTTTCTTCTTTCTGGGATATTAGTGGCCACTTTGAAGAAGAGGATTCAGAAATTCAATACTCTGTTTGAAGGGGTTCGTTCCACTCAATCCAGATGGAGTGTGGAGTATTGGCGGTTACGGGAGGAGCTTCGTCGCTCGATGGTGGACACATTGGTTCCTGCTTACAAGTCATTTCTAGAACGATACAACAGTTGCATAGGGATAAGAAACTCCGAAGCACAAACGTCAAGTACTCGGCTGAGCAGCTTCAGGCTTTGA

Network for GWHGAAZE018029

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF03081.16	Exo70	1	78	1.00E-14

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K07195	EXOC7, EXO70	Insulin signaling pathway	map04910

Gene Ontology

GO term	Ontology	Name
GO:0006887	biological_process	exocytosis
GO:0000145	cellular_component	exocyst

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	7.100
	SRR3591706	second leaf	18.170
	SRR3591707	mature leaf	24.025
	SRR3591708	Shoot apex	11.765
	SRR3591709	Stem	17.738
	SRR3591710	White floral bud	2.864
	SRR3591711	White flower	5.133
	SRR3591712	Green floral bud	0.206
	SRR3591713	Yellow flower	0.581
SRP173429	SRR8316895	Juvenile bud stage	0.218
	SRR8316896	Juvenile bud stage	0.186
	SRR8316897	Juvenile bud stage	1.019
	SRR8316894	Third green stage	0.000
	SRR8316900	Third green stage	0.000
	SRR8316901	Third green stage	0.075
	SRR8316898	Complete white stage	0.000
	SRR8316899	Complete white stage	0.135
	SRR8316903	Complete white stage	0.000
	SRR8316902	Silver flowering stage	0.000
	SRR8316904	Silver flowering stage	0.000
	SRR8316905	Silver flowering stage	0.000
	SRR8316906	Gold flowering stage	0.000
	SRR8316907	Gold flowering stage	0.000
	SRR8316908	Gold flowering stage	0.000
SRP132670	SRR6706286	Control	0.248
	SRR6706287	Light intensity 50%	0.148
	SRR6706288	Light intensity 20%	0.307
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	1.028
	CNS0095593	Slightly white alabastrum(diploid) 2	0.255
	CNS0095594	Slightly white alabastrum(diploid) 3	1.486
	CNS0095595	Whole white alabastrum(diploid) 2	0.757
	CNS0095596	Whole white alabastrum(diploid) 3	0.814
	CNS0095597	Whole white alabastrum(diploid) 4	1.352
	CNS0095598	Silvery flower (diploied) 1	0.537
	CNS0095599	Silvery flower (diploied) 2	0.691
	CNS0095600	Silvery flower (diploied) 3	0.614
	CNS0095601	Golden flower (diploid) 1	1.736
	CNS0095602	Golden flower (diploid) 2	0.420
	CNS0095603	Golden flower (diploid) 3	0.367
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.953
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.706
	CNS0095606	Slightly white alabastrum(tetraploid) 3	1.077
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.518
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.632
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.032
	CNS0095610	Silvery flower (tetraploid) 1	0.000
	CNS0095611	Silvery flower (tetraploid) 2	0.231
	CNS0095612	Silvery flower (tetraploid) 3	0.000
	CNS0095613	Golden flower (tetraploid) 1	0.000
	CNS0095614	Golden flower (tetraploid) 2	0.000
	CNS0095615	Golden flower (tetraploid) 3	0.000
CRA001975	CRR073297	Stem 1	0.243
	CRR073298	Stem 2	0.000
	CRR073299	Stem 3	0.257
	CRR073300	Leaf 1	0.156
	CRR073301	Leaf 2	0.000
	CRR073302	Leaf 3	0.172
	CRR073303	Juvenile bud 1	0.835
	CRR073304	Juvenile bud 2	0.000
	CRR073305	Juvenile bud 3	0.377
	CRR073306	Third green 1	0.000
	CRR073307	Third green 2	0.181
	CRR073308	Third green 3	0.000
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.000
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	1.514
	CRR073316	Gold flowering 2	0.526
	CRR073317	Gold flowering 3	0.000
	CRR073318	Tawny withering 1	0.345
	CRR073319	Tawny withering 2	1.299
	CRR073320	Tawny withering 3	0.000