Gene detail

Detail information of GWHGAAZE018051

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_004173217.1	6.92925E-81	PREDICTED: probable calcium-binding protein CML15-like [Cucumis sativus]
Swissprot	tr\|Q9FZ75\|CML15_ARATH	6E-76	Probable calcium-binding protein CML15
trEMBL	tr\|A0A0A0LUS7\|A0A0A0LUS7_CUCSA	3E-81	Uncharacterized protein {ECO:0000313\|EMBL:KGN63786.1}
TAIR10	AT1G18530.1	4E-50	EF hand calcium-binding protein family

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000005	gene	14104299	14104721	+
GWHAAZE00000005	mRNA	14104299	14104721	+
GWHAAZE00000005	exon	14104299	14104721	+
GWHAAZE00000005	CDS	14104299	14104721	+

Transcript Sequence
>GWHTAAZE018073 ATGGACTCCGACGGGAGCCTCACCCACCTTGAACTGGCGGCGCTCCTACGATCCCTCGGACTCAAACCCTCCGGGGACCACATCCACGCCTTATTAGCCAACATGGATTCTAACGGTAACGGCGCCGTCGAATTTGACGAACTGGTCAAAACGATTATGCCGTACGTCAACGACGAGATCCTCGTAAATCAGGAGCAATTATTGGAGGTGTTTCGATCGTTCGATCGGGACGGGAACGGGTATATTACGCTTGCTGAGCTGGCGGGATCGATGGCTAAGATGGGACAGGCGTTAACCTACCGTGAGTTGACGGAGATGATCAATGAGGCTGATACGGACGGTGACGGTGTTATTAGCTTTAATGAATTTGCGACGATCATGGCTAAATCCGCCGCTGATTTTCTTGGCCTAAGGGTTTCGTAG

Network for GWHGAAZE018051

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF13833.7	EF-hand_8	4	49	0.0015
PF13499.7	EF-hand_7	65	127	4.40E-15

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K13448	CML	Plant-pathogen interaction	map04626

Gene Ontology

GO term	Ontology	Name
GO:0005509	molecular_function	calcium ion binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	12.865
	SRR3591706	second leaf	4.993
	SRR3591707	mature leaf	4.725
	SRR3591708	Shoot apex	4.526
	SRR3591709	Stem	13.256
	SRR3591710	White floral bud	24.243
	SRR3591711	White flower	10.061
	SRR3591712	Green floral bud	7.328
	SRR3591713	Yellow flower	4.790
SRP173429	SRR8316895	Juvenile bud stage	10.484
	SRR8316896	Juvenile bud stage	10.997
	SRR8316897	Juvenile bud stage	3.897
	SRR8316894	Third green stage	4.710
	SRR8316900	Third green stage	9.699
	SRR8316901	Third green stage	11.976
	SRR8316898	Complete white stage	2.903
	SRR8316899	Complete white stage	20.165
	SRR8316903	Complete white stage	3.922
	SRR8316902	Silver flowering stage	2.923
	SRR8316904	Silver flowering stage	2.809
	SRR8316905	Silver flowering stage	1.777
	SRR8316906	Gold flowering stage	4.731
	SRR8316907	Gold flowering stage	3.595
	SRR8316908	Gold flowering stage	7.427
SRP132670	SRR6706286	Control	11.977
	SRR6706287	Light intensity 50%	11.620
	SRR6706288	Light intensity 20%	10.350
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	11.506
	CNS0095593	Slightly white alabastrum(diploid) 2	10.110
	CNS0095594	Slightly white alabastrum(diploid) 3	15.715
	CNS0095595	Whole white alabastrum(diploid) 2	10.808
	CNS0095596	Whole white alabastrum(diploid) 3	4.630
	CNS0095597	Whole white alabastrum(diploid) 4	8.555
	CNS0095598	Silvery flower (diploied) 1	21.775
	CNS0095599	Silvery flower (diploied) 2	12.992
	CNS0095600	Silvery flower (diploied) 3	13.082
	CNS0095601	Golden flower (diploid) 1	18.115
	CNS0095602	Golden flower (diploid) 2	15.684
	CNS0095603	Golden flower (diploid) 3	15.371
	CNS0095604	Slightly white alabastrum(tetraploid) 1	4.913
	CNS0095605	Slightly white alabastrum(tetraploid) 2	3.650
	CNS0095606	Slightly white alabastrum(tetraploid) 3	7.651
	CNS0095607	Whole white alabastrum(tetraploid) 1	8.444
	CNS0095608	Whole white alabastrum(tetraploid) 2	6.713
	CNS0095609	Whole white alabastrum(tetraploid) 3	6.589
	CNS0095610	Silvery flower (tetraploid) 1	5.247
	CNS0095611	Silvery flower (tetraploid) 2	4.293
	CNS0095612	Silvery flower (tetraploid) 3	7.831
	CNS0095613	Golden flower (tetraploid) 1	4.961
	CNS0095614	Golden flower (tetraploid) 2	6.282
	CNS0095615	Golden flower (tetraploid) 3	3.226
CRA001975	CRR073297	Stem 1	7.276
	CRR073298	Stem 2	9.393
	CRR073299	Stem 3	7.928
	CRR073300	Leaf 1	17.188
	CRR073301	Leaf 2	15.444
	CRR073302	Leaf 3	11.547
	CRR073303	Juvenile bud 1	10.514
	CRR073304	Juvenile bud 2	14.367
	CRR073305	Juvenile bud 3	16.837
	CRR073306	Third green 1	13.290
	CRR073307	Third green 2	14.416
	CRR073308	Third green 3	18.650
	CRR073309	Second white 1	4.684
	CRR073310	Second white 2	4.462
	CRR073311	Second white 3	1.529
	CRR073312	Silver flowering 1	3.151
	CRR073313	Silver flowering 2	9.459
	CRR073314	Silver flowering 3	8.205
	CRR073315	Gold flowering 1	22.942
	CRR073316	Gold flowering 2	12.774
	CRR073317	Gold flowering 3	26.054
	CRR073318	Tawny withering 1	36.821
	CRR073319	Tawny withering 2	31.943
	CRR073320	Tawny withering 3	36.743