Gene detail

Detail information of GWHGAAZE018141

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	CBI32808.3	4.0665E-127	unnamed protein product [Vitis vinifera]
Swissprot	tr\|Q9ZRA8\|TBB5_WHEAT	5E-129	Tubulin beta-5 chain
trEMBL	tr\|M0Y723\|M0Y723_HORVD	8E-128	Uncharacterized protein {ECO:0000313\|EnsemblPlants:MLOC_66337.1}
TAIR10	AT5G12250.1	2E-102	beta-6 tubulin

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000005	gene	15651904	15652617	+
GWHAAZE00000005	mRNA	15651904	15652617	+
GWHAAZE00000005	exon	15651904	15652297	+
GWHAAZE00000005	exon	15652412	15652617	+
GWHAAZE00000005	CDS	15651904	15652297	+
GWHAAZE00000005	CDS	15652412	15652617	+

Transcript Sequence
>GWHTAAZE018163 ATGCGTGAGATTCTTCACATTCAAGGAGGGCAATGCGGGAACCAAATCGGATCAAAATTCTGGGAAGTTGTTTGTGACGAACACGGCATTGACCCCACCGGCCGGTACGTCGGAACTTCCCAACTCCAACTCGAGAGGGTCAATGTTTACTACAACGAAGCTAGCGGCGGCAGGTATGTTCCACGCGCTGTCCTAATGGACCTTGAACCGGGCACAATGGACAGCATAAGGACCGGCCCGTATGGACAGATTTTCAGGCCCGACAACTACGTTTTCGGTCAATCAGGGGCCGGAAACAATTGGGCCAAAGGCCATTACACCGAAGGAGCCGAGTTAATAGACTCGGTTCTTGACGTTGTTAGGAAAGAAGTTGAGAACTGTGACTGCTTGCAAGGGTTTCAAGTGTGTCATTCTTTGGGAGGAGGGACAGGATCGGGGATGGGAACACTGCTGATATCGAAGATAAGGGAAGAATATCCTGATAGGATCTCATTCTTTCCATCTCCAAAGGTGTCCGACACAGTAGTGGAGCCGTATAATGCGACTCTTTCGGTGCATCAGCTAGTGGAGAATGCAGATGAGTGTATGGTGCTTGACAAT

Network for GWHGAAZE018141

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00091.26	Tubulin	3	200	2.60E-62

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K07375	TUBB	Phagosome	map04145
K07375	TUBB	Gap junction	map04540

Gene Ontology

GO term	Ontology	Name
GO:0007017	biological_process	microtubule-based process
GO:0005874	cellular_component	microtubule
GO:0003924	molecular_function	GTPase activity
GO:0005525	molecular_function	GTP binding
GO:0005200	molecular_function	structural constituent of cytoskeleton

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.000
	SRR3591706	second leaf	2.439
	SRR3591707	mature leaf	0.087
	SRR3591708	Shoot apex	2.987
	SRR3591709	Stem	0.000
	SRR3591710	White floral bud	0.174
	SRR3591711	White flower	0.000
	SRR3591712	Green floral bud	0.274
	SRR3591713	Yellow flower	0.000
SRP173429	SRR8316895	Juvenile bud stage	0.440
	SRR8316896	Juvenile bud stage	0.773
	SRR8316897	Juvenile bud stage	0.187
	SRR8316894	Third green stage	0.113
	SRR8316900	Third green stage	0.271
	SRR8316901	Third green stage	0.264
	SRR8316898	Complete white stage	0.000
	SRR8316899	Complete white stage	0.470
	SRR8316903	Complete white stage	0.000
	SRR8316902	Silver flowering stage	0.000
	SRR8316904	Silver flowering stage	0.000
	SRR8316905	Silver flowering stage	0.000
	SRR8316906	Gold flowering stage	0.000
	SRR8316907	Gold flowering stage	0.000
	SRR8316908	Gold flowering stage	0.000
SRP132670	SRR6706286	Control	0.344
	SRR6706287	Light intensity 50%	0.347
	SRR6706288	Light intensity 20%	0.417
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.202
	CNS0095593	Slightly white alabastrum(diploid) 2	1.037
	CNS0095594	Slightly white alabastrum(diploid) 3	0.013
	CNS0095595	Whole white alabastrum(diploid) 2	0.293
	CNS0095596	Whole white alabastrum(diploid) 3	0.079
	CNS0095597	Whole white alabastrum(diploid) 4	0.000
	CNS0095598	Silvery flower (diploied) 1	0.515
	CNS0095599	Silvery flower (diploied) 2	1.564
	CNS0095600	Silvery flower (diploied) 3	0.240
	CNS0095601	Golden flower (diploid) 1	0.665
	CNS0095602	Golden flower (diploid) 2	0.591
	CNS0095603	Golden flower (diploid) 3	0.415
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.731
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.537
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.286
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.170
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.000
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.028
	CNS0095610	Silvery flower (tetraploid) 1	0.000
	CNS0095611	Silvery flower (tetraploid) 2	0.120
	CNS0095612	Silvery flower (tetraploid) 3	0.000
	CNS0095613	Golden flower (tetraploid) 1	0.000
	CNS0095614	Golden flower (tetraploid) 2	0.000
	CNS0095615	Golden flower (tetraploid) 3	0.000
CRA001975	CRR073297	Stem 1	0.932
	CRR073298	Stem 2	0.416
	CRR073299	Stem 3	0.519
	CRR073300	Leaf 1	0.158
	CRR073301	Leaf 2	0.194
	CRR073302	Leaf 3	0.329
	CRR073303	Juvenile bud 1	0.362
	CRR073304	Juvenile bud 2	0.036
	CRR073305	Juvenile bud 3	0.035
	CRR073306	Third green 1	0.000
	CRR073307	Third green 2	0.000
	CRR073308	Third green 3	0.000
	CRR073309	Second white 1	0.004
	CRR073310	Second white 2	0.000
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.249
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	1.514
	CRR073316	Gold flowering 2	0.745
	CRR073317	Gold flowering 3	1.052
	CRR073318	Tawny withering 1	0.582
	CRR073319	Tawny withering 2	0.020
	CRR073320	Tawny withering 3	1.106