Gene detail

Detail information of GWHGAAZE018164

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_006838023.1	2.17526E-77	hypothetical protein AMTR_s00091p00066640 [Amborella trichopoda]
Swissprot	tr\|Q9LUQ6\|RL192_ARATH	2E-85	60S ribosomal protein L19-2
trEMBL	tr\|W1NT99\|W1NT99_AMBTC	8E-78	Ribosomal protein L19 {ECO:0000256\|RuleBase:RU000574}
TAIR10	AT1G02780.1	6E-56	Ribosomal protein L19e family protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000005	gene	15892747	15893585	+
GWHAAZE00000005	mRNA	15892747	15893585	+
GWHAAZE00000005	exon	15892747	15892909	+
GWHAAZE00000005	exon	15893185	15893585	+
GWHAAZE00000005	five_prime_UTR	15892747	15892797	+
GWHAAZE00000005	CDS	15892798	15892909	+
GWHAAZE00000005	CDS	15893185	15893585	+

Transcript Sequence
>GWHTAAZE018186 ACGCACACACAACTGTGTTCTGTAAAACAGAGGGAAACGGAAGAAGAGAAAATGGTGTCTTTAAGGCTACAGAAGCGATTAGCAGCCAGCATTCTCAACTGCGGGAAGGGGAAGGTGTGGCTTGACCCCAACGAGATCAGCAACATCTCCACGGCCAATTCTAGGATGAACATGCGGAAACTCATAAAAGATGGTCTAATCATCAAACTGCCTGCAAAAATTCACGCAAGGACTCATGCTCAGGAAGCAATAGATGCAAAGAAAAAGGGGAATCACTCGGGATATGGAAAGAGGAAAGGAACACGAGAGGCAAGGCTACCAACAAAGGTTCTGTGGATGAGAAGAATGAGAGTGTTGCGACGCTTGCTACGCAAGTATAGATATTCCGATAAGGTTGATAAGCACATGTACCATAGCATGTACATGAACGTGAAAGGAAACGTATTCAAGAATAAACGCGTTCTAATGGAGAGAATTCACAAGTTGAAGTCTGAGAAAGAAAGAGAGAAGACGCTCTTTGGCCAATTAAAAGCCAAGAAAGCAAATTACATCGCCCTGGTGTAG

Network for GWHGAAZE018164

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF01280.21	Ribosomal_L19e	4	145	3.80E-59

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K02885	RP-L19e, RPL19	Ribosome	map03010

Gene Ontology

GO term	Ontology	Name
GO:0006412	biological_process	translation
GO:0022625	cellular_component	cytosolic large ribosomal subunit
GO:0005840	cellular_component	ribosome
GO:0003735	molecular_function	structural constituent of ribosome

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	1.377
	SRR3591706	second leaf	1.039
	SRR3591707	mature leaf	0.063
	SRR3591708	Shoot apex	1.305
	SRR3591709	Stem	0.980
	SRR3591710	White floral bud	2.162
	SRR3591711	White flower	1.035
	SRR3591712	Green floral bud	1.554
	SRR3591713	Yellow flower	12.946
SRP173429	SRR8316895	Juvenile bud stage	0.391
	SRR8316896	Juvenile bud stage	0.425
	SRR8316897	Juvenile bud stage	0.753
	SRR8316894	Third green stage	0.092
	SRR8316900	Third green stage	0.548
	SRR8316901	Third green stage	0.057
	SRR8316898	Complete white stage	0.204
	SRR8316899	Complete white stage	0.366
	SRR8316903	Complete white stage	1.504
	SRR8316902	Silver flowering stage	2.441
	SRR8316904	Silver flowering stage	2.935
	SRR8316905	Silver flowering stage	0.990
	SRR8316906	Gold flowering stage	16.915
	SRR8316907	Gold flowering stage	8.492
	SRR8316908	Gold flowering stage	23.616
SRP132670	SRR6706286	Control	1.082
	SRR6706287	Light intensity 50%	1.075
	SRR6706288	Light intensity 20%	0.967
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.456
	CNS0095593	Slightly white alabastrum(diploid) 2	2.481
	CNS0095594	Slightly white alabastrum(diploid) 3	1.675
	CNS0095595	Whole white alabastrum(diploid) 2	4.428
	CNS0095596	Whole white alabastrum(diploid) 3	0.244
	CNS0095597	Whole white alabastrum(diploid) 4	2.869
	CNS0095598	Silvery flower (diploied) 1	3.216
	CNS0095599	Silvery flower (diploied) 2	3.560
	CNS0095600	Silvery flower (diploied) 3	2.811
	CNS0095601	Golden flower (diploid) 1	7.139
	CNS0095602	Golden flower (diploid) 2	3.742
	CNS0095603	Golden flower (diploid) 3	3.410
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.487
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.000
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.317
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.478
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.288
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.374
	CNS0095610	Silvery flower (tetraploid) 1	11.287
	CNS0095611	Silvery flower (tetraploid) 2	2.660
	CNS0095612	Silvery flower (tetraploid) 3	2.496
	CNS0095613	Golden flower (tetraploid) 1	88.262
	CNS0095614	Golden flower (tetraploid) 2	16.258
	CNS0095615	Golden flower (tetraploid) 3	11.887
CRA001975	CRR073297	Stem 1	0.404
	CRR073298	Stem 2	0.676
	CRR073299	Stem 3	0.380
	CRR073300	Leaf 1	0.740
	CRR073301	Leaf 2	1.734
	CRR073302	Leaf 3	0.177
	CRR073303	Juvenile bud 1	1.529
	CRR073304	Juvenile bud 2	1.173
	CRR073305	Juvenile bud 3	0.880
	CRR073306	Third green 1	0.212
	CRR073307	Third green 2	0.590
	CRR073308	Third green 3	0.208
	CRR073309	Second white 1	2.693
	CRR073310	Second white 2	7.596
	CRR073311	Second white 3	13.605
	CRR073312	Silver flowering 1	2.306
	CRR073313	Silver flowering 2	5.603
	CRR073314	Silver flowering 3	4.259
	CRR073315	Gold flowering 1	0.000
	CRR073316	Gold flowering 2	0.315
	CRR073317	Gold flowering 3	0.072
	CRR073318	Tawny withering 1	0.598
	CRR073319	Tawny withering 2	1.024
	CRR073320	Tawny withering 3	0.337