Gene detail

Detail information of GWHGAAZE018258

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_009774812.1	1.01359E-65	PREDICTED: alpha-1,3-mannosyl-glycoprotein 2-beta-N-acetylglucosaminyltransferase-like isoform X3 [Nicotiana sylvestris]
Swissprot	tr\|Q9XGM8\|MGAT1_ARATH	2E-51	Alpha-1,3-mannosyl-glycoprotein 2-beta-N-acetylglucosaminyltransferase
trEMBL	tr\|Q8VXD3\|Q8VXD3_TOBAC	1E-63	N-acetylglucosaminyltransferase I {ECO:0000313\|EMBL:CAC80702.1}
TAIR10	AT4G38240.3	8E-44	alpha-1,3-mannosyl-glycoprotein beta-1,2-N-acetylglucosaminyltransferase, putative

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000005	gene	17148856	17150148	-
GWHAAZE00000005	mRNA	17148856	17150148	-
GWHAAZE00000005	exon	17150134	17150148	-
GWHAAZE00000005	exon	17149834	17149929	-
GWHAAZE00000005	exon	17149411	17149581	-
GWHAAZE00000005	exon	17148856	17148972	-
GWHAAZE00000005	CDS	17150134	17150148	-
GWHAAZE00000005	CDS	17149834	17149929	-
GWHAAZE00000005	CDS	17149411	17149581	-
GWHAAZE00000005	CDS	17148856	17148972	-

Transcript Sequence
>GWHTAAZE018280 ATGTTACTTGCCAAAGGTTCTAGTTTGGGACAGTATTTCAAGCAATATCTTGAGCCTATTAAGATGAATGATGTCCAGGCATGTAACAATTTCTCTTACCTTTTTTTGTTTGATAAGTATGTGCAGCATTTTGGTGACATTGTTAAGAGTGCAAAACCTGTACATGGAGCAGATGCTGTTCTGAAGGCATATAATATAGACGGCGACGTGCGTATCAAGTACTATGACCAGACAGATTTTGAACGCATTGCACGTCAATTTGGCATTTTTGAAGAATGGAAGGATGGTGTGCCAAGAACAGCATATAAAGGAGTGGTGGTTTTTCGGTACCAAACATCAAGGCGTATATTCCTTGTGGGTCCAGATTCTCTCCAACAGCTTGGGATTGAAAATTCTTAA

Network for GWHGAAZE018258

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF03071.16	GNT-I	5	131	8.00E-38

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K00726	MGAT1	Metabolic pathways	map01100
		N-Glycan biosynthesis	map00510
		Various types of N-glycan biosynthesis	map00513

Gene Ontology

GO term	Ontology	Name
GO:0006486	biological_process	protein glycosylation
GO:0008375	molecular_function	acetylglucosaminyltransferase activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	55.546
	SRR3591706	second leaf	22.566
	SRR3591707	mature leaf	19.906
	SRR3591708	Shoot apex	32.626
	SRR3591709	Stem	45.997
	SRR3591710	White floral bud	51.764
	SRR3591711	White flower	48.226
	SRR3591712	Green floral bud	51.451
	SRR3591713	Yellow flower	52.377
SRP173429	SRR8316895	Juvenile bud stage	28.077
	SRR8316896	Juvenile bud stage	37.052
	SRR8316897	Juvenile bud stage	15.307
	SRR8316894	Third green stage	15.934
	SRR8316900	Third green stage	42.307
	SRR8316901	Third green stage	41.471
	SRR8316898	Complete white stage	19.813
	SRR8316899	Complete white stage	61.580
	SRR8316903	Complete white stage	22.369
	SRR8316902	Silver flowering stage	13.378
	SRR8316904	Silver flowering stage	21.468
	SRR8316905	Silver flowering stage	9.800
	SRR8316906	Gold flowering stage	25.374
	SRR8316907	Gold flowering stage	25.343
	SRR8316908	Gold flowering stage	27.793
SRP132670	SRR6706286	Control	13.752
	SRR6706287	Light intensity 50%	17.377
	SRR6706288	Light intensity 20%	19.887
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	42.626
	CNS0095593	Slightly white alabastrum(diploid) 2	48.012
	CNS0095594	Slightly white alabastrum(diploid) 3	47.031
	CNS0095595	Whole white alabastrum(diploid) 2	40.887
	CNS0095596	Whole white alabastrum(diploid) 3	45.910
	CNS0095597	Whole white alabastrum(diploid) 4	29.459
	CNS0095598	Silvery flower (diploied) 1	36.092
	CNS0095599	Silvery flower (diploied) 2	27.903
	CNS0095600	Silvery flower (diploied) 3	26.617
	CNS0095601	Golden flower (diploid) 1	21.172
	CNS0095602	Golden flower (diploid) 2	26.608
	CNS0095603	Golden flower (diploid) 3	22.152
	CNS0095604	Slightly white alabastrum(tetraploid) 1	51.435
	CNS0095605	Slightly white alabastrum(tetraploid) 2	55.400
	CNS0095606	Slightly white alabastrum(tetraploid) 3	63.593
	CNS0095607	Whole white alabastrum(tetraploid) 1	42.656
	CNS0095608	Whole white alabastrum(tetraploid) 2	43.807
	CNS0095609	Whole white alabastrum(tetraploid) 3	43.328
	CNS0095610	Silvery flower (tetraploid) 1	31.929
	CNS0095611	Silvery flower (tetraploid) 2	32.580
	CNS0095612	Silvery flower (tetraploid) 3	35.789
	CNS0095613	Golden flower (tetraploid) 1	27.026
	CNS0095614	Golden flower (tetraploid) 2	36.496
	CNS0095615	Golden flower (tetraploid) 3	17.560
CRA001975	CRR073297	Stem 1	11.560
	CRR073298	Stem 2	13.391
	CRR073299	Stem 3	5.360
	CRR073300	Leaf 1	12.972
	CRR073301	Leaf 2	12.122
	CRR073302	Leaf 3	8.808
	CRR073303	Juvenile bud 1	12.146
	CRR073304	Juvenile bud 2	7.528
	CRR073305	Juvenile bud 3	13.890
	CRR073306	Third green 1	5.205
	CRR073307	Third green 2	6.715
	CRR073308	Third green 3	4.377
	CRR073309	Second white 1	4.760
	CRR073310	Second white 2	4.578
	CRR073311	Second white 3	6.417
	CRR073312	Silver flowering 1	5.391
	CRR073313	Silver flowering 2	3.275
	CRR073314	Silver flowering 3	2.150
	CRR073315	Gold flowering 1	10.166
	CRR073316	Gold flowering 2	9.623
	CRR073317	Gold flowering 3	3.714
	CRR073318	Tawny withering 1	13.495
	CRR073319	Tawny withering 2	19.948
	CRR073320	Tawny withering 3	15.902