Gene detail

Detail information of GWHGAAZE018374

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	CDO96966.1	6.60119E-44	unnamed protein product [Coffea canephora]
Swissprot	tr\|P32295\|ARG7_VIGRR	8E-30	Indole-3-acetic acid-induced protein ARG7
trEMBL	tr\|A0A068TL59\|A0A068TL59_COFCA	2E-44	Coffea canephora DH200=94 genomic scaffold, scaffold_1 {ECO:0000313\|EMBL:CDO96966.1}
TAIR10	AT4G38840.1	4E-29	SAUR-like auxin-responsive protein family

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000005	gene	18645697	18645999	-
GWHAAZE00000005	mRNA	18645697	18645999	-
GWHAAZE00000005	exon	18645697	18645999	-
GWHAAZE00000005	CDS	18645697	18645999	-

Transcript Sequence
>GWHTAAZE018396 ATGGGCATTCGCTTGCCTTCCCTGATTCTTAGTGCCAAGCAAATTCTAAGACAGCACAATCTTATTAAGACCAGAAATAAGGGAGATGTTCCTAAAGGTCATTTAGCAGTGTATGTAGGAGTGGGAGAGACTGAGAAGAAAAGGTTTGTGGTTCCAATAGCTTACCTCACTCATCCATCTTTCCAAGACTTATTGCGTGTTGCAGAGGAAGAGTATGGATATGACCATCCGATGGGAGGTCTAACTATTCCCTGCAGAGAAGATGCTTTCATCCATCTCACTTCTCGATTGACTGCTTCATGA

Network for GWHGAAZE018374

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF02519.15	Auxin_inducible	21	96	5.70E-25

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K14488	SAUR	Plant hormone signal transduction	map04075

Gene Ontology

GO term	Ontology	Name
GO:0009733	biological_process	response to auxin

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.302
	SRR3591706	second leaf	0.405
	SRR3591707	mature leaf	0.388
	SRR3591708	Shoot apex	1.052
	SRR3591709	Stem	1.556
	SRR3591710	White floral bud	0.654
	SRR3591711	White flower	0.327
	SRR3591712	Green floral bud	0.555
	SRR3591713	Yellow flower	0.198
SRP173429	SRR8316895	Juvenile bud stage	0.265
	SRR8316896	Juvenile bud stage	0.113
	SRR8316897	Juvenile bud stage	0.276
	SRR8316894	Third green stage	0.112
	SRR8316900	Third green stage	1.382
	SRR8316901	Third green stage	0.690
	SRR8316898	Complete white stage	1.392
	SRR8316899	Complete white stage	1.527
	SRR8316903	Complete white stage	4.661
	SRR8316902	Silver flowering stage	0.478
	SRR8316904	Silver flowering stage	1.900
	SRR8316905	Silver flowering stage	1.374
	SRR8316906	Gold flowering stage	0.831
	SRR8316907	Gold flowering stage	0.000
	SRR8316908	Gold flowering stage	1.292
SRP132670	SRR6706286	Control	0.018
	SRR6706287	Light intensity 50%	0.029
	SRR6706288	Light intensity 20%	0.058
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.074
	CNS0095593	Slightly white alabastrum(diploid) 2	0.849
	CNS0095594	Slightly white alabastrum(diploid) 3	0.939
	CNS0095595	Whole white alabastrum(diploid) 2	1.049
	CNS0095596	Whole white alabastrum(diploid) 3	1.509
	CNS0095597	Whole white alabastrum(diploid) 4	1.887
	CNS0095598	Silvery flower (diploied) 1	0.000
	CNS0095599	Silvery flower (diploied) 2	0.000
	CNS0095600	Silvery flower (diploied) 3	1.105
	CNS0095601	Golden flower (diploid) 1	1.281
	CNS0095602	Golden flower (diploid) 2	0.575
	CNS0095603	Golden flower (diploid) 3	0.561
	CNS0095604	Slightly white alabastrum(tetraploid) 1	1.575
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.338
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.606
	CNS0095607	Whole white alabastrum(tetraploid) 1	2.537
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.175
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.693
	CNS0095610	Silvery flower (tetraploid) 1	0.350
	CNS0095611	Silvery flower (tetraploid) 2	0.600
	CNS0095612	Silvery flower (tetraploid) 3	0.407
	CNS0095613	Golden flower (tetraploid) 1	0.000
	CNS0095614	Golden flower (tetraploid) 2	0.023
	CNS0095615	Golden flower (tetraploid) 3	0.127
CRA001975	CRR073297	Stem 1	0.000
	CRR073298	Stem 2	0.592
	CRR073299	Stem 3	0.139
	CRR073300	Leaf 1	0.417
	CRR073301	Leaf 2	0.372
	CRR073302	Leaf 3	0.353
	CRR073303	Juvenile bud 1	0.102
	CRR073304	Juvenile bud 2	0.000
	CRR073305	Juvenile bud 3	0.001
	CRR073306	Third green 1	1.553
	CRR073307	Third green 2	1.307
	CRR073308	Third green 3	1.208
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.713
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	0.000
	CRR073316	Gold flowering 2	0.044
	CRR073317	Gold flowering 3	0.230
	CRR073318	Tawny withering 1	0.744
	CRR073319	Tawny withering 2	0.000
	CRR073320	Tawny withering 3	0.000