Gene detail

Detail information of GWHGAAZE018376

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	CDP18416.1	6.01474E-42	unnamed protein product [Coffea canephora]
Swissprot	tr\|P33079\|A10A5_SOYBN	5E-33	Auxin-induced protein 10A5
trEMBL	tr\|A0A068VCE0\|A0A068VCE0_COFCA	2E-42	Coffea canephora DH200=94 genomic scaffold, scaffold_235 {ECO:0000313\|EMBL:CDP18416.1}
TAIR10	AT4G38840.1	2E-29	SAUR-like auxin-responsive protein family

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000005	gene	18704923	18705210	+
GWHAAZE00000005	mRNA	18704923	18705210	+
GWHAAZE00000005	exon	18704923	18705210	+
GWHAAZE00000005	CDS	18704923	18705210	+

Transcript Sequence
>GWHTAAZE018398 ATGGGTATCCGTATGCTTCATATTATTCATACTAAGAAGCTTCTTAGAATGTCTTCATTTACAGCAGCTTCGACCGCTATAGTTGTCCCTAAGGGACATTTTGCAGTTTATGTTGGTGAGCACGAGAAGAAGAGATTTGTGATCCCCGTATCGTTCTTGAACGAGCCTTCATTCCAAGACCTCTTAAGTCAAGCTGAGGAAGAGTTCGGCTTTGATCATCCAATGGGTGGCCTCACAATCCCCTGCAGAGAGGAAATATTTATTGACCTGACTTCTCGCTTTAGCTAA

Network for GWHGAAZE018376

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF02519.15	Auxin_inducible	13	92	7.00E-25

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K14488	SAUR	Plant hormone signal transduction	map04075

Gene Ontology

GO term	Ontology	Name
GO:0009733	biological_process	response to auxin

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	11.607
	SRR3591706	second leaf	11.469
	SRR3591707	mature leaf	6.734
	SRR3591708	Shoot apex	11.675
	SRR3591709	Stem	3.437
	SRR3591710	White floral bud	2.781
	SRR3591711	White flower	8.982
	SRR3591712	Green floral bud	2.576
	SRR3591713	Yellow flower	0.737
SRP173429	SRR8316895	Juvenile bud stage	0.233
	SRR8316896	Juvenile bud stage	2.972
	SRR8316897	Juvenile bud stage	0.423
	SRR8316894	Third green stage	0.771
	SRR8316900	Third green stage	2.816
	SRR8316901	Third green stage	2.983
	SRR8316898	Complete white stage	15.193
	SRR8316899	Complete white stage	3.080
	SRR8316903	Complete white stage	22.023
	SRR8316902	Silver flowering stage	18.992
	SRR8316904	Silver flowering stage	26.342
	SRR8316905	Silver flowering stage	21.115
	SRR8316906	Gold flowering stage	41.647
	SRR8316907	Gold flowering stage	25.818
	SRR8316908	Gold flowering stage	24.924
SRP132670	SRR6706286	Control	5.133
	SRR6706287	Light intensity 50%	5.153
	SRR6706288	Light intensity 20%	3.882
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	4.700
	CNS0095593	Slightly white alabastrum(diploid) 2	8.526
	CNS0095594	Slightly white alabastrum(diploid) 3	4.283
	CNS0095595	Whole white alabastrum(diploid) 2	4.622
	CNS0095596	Whole white alabastrum(diploid) 3	9.033
	CNS0095597	Whole white alabastrum(diploid) 4	6.898
	CNS0095598	Silvery flower (diploied) 1	4.380
	CNS0095599	Silvery flower (diploied) 2	17.698
	CNS0095600	Silvery flower (diploied) 3	16.921
	CNS0095601	Golden flower (diploid) 1	4.200
	CNS0095602	Golden flower (diploid) 2	4.172
	CNS0095603	Golden flower (diploid) 3	5.364
	CNS0095604	Slightly white alabastrum(tetraploid) 1	2.363
	CNS0095605	Slightly white alabastrum(tetraploid) 2	1.546
	CNS0095606	Slightly white alabastrum(tetraploid) 3	4.210
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.848
	CNS0095608	Whole white alabastrum(tetraploid) 2	3.444
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.867
	CNS0095610	Silvery flower (tetraploid) 1	5.260
	CNS0095611	Silvery flower (tetraploid) 2	8.412
	CNS0095612	Silvery flower (tetraploid) 3	3.857
	CNS0095613	Golden flower (tetraploid) 1	4.850
	CNS0095614	Golden flower (tetraploid) 2	1.665
	CNS0095615	Golden flower (tetraploid) 3	32.759
CRA001975	CRR073297	Stem 1	4.327
	CRR073298	Stem 2	6.086
	CRR073299	Stem 3	2.464
	CRR073300	Leaf 1	8.559
	CRR073301	Leaf 2	11.403
	CRR073302	Leaf 3	9.405
	CRR073303	Juvenile bud 1	6.404
	CRR073304	Juvenile bud 2	3.942
	CRR073305	Juvenile bud 3	4.875
	CRR073306	Third green 1	36.388
	CRR073307	Third green 2	71.504
	CRR073308	Third green 3	42.116
	CRR073309	Second white 1	5.650
	CRR073310	Second white 2	5.432
	CRR073311	Second white 3	2.248
	CRR073312	Silver flowering 1	0.474
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	1.976
	CRR073316	Gold flowering 2	5.026
	CRR073317	Gold flowering 3	3.806
	CRR073318	Tawny withering 1	0.000
	CRR073319	Tawny withering 2	0.000
	CRR073320	Tawny withering 3	0.000