Gene detail

Detail information of GWHGAAZE018380

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_006487294.1	1.07935E-42	PREDICTED: auxin-induced protein 10A5-like [Citrus sinensis]
Swissprot	tr\|P32295\|ARG7_VIGRR	6E-34	Indole-3-acetic acid-induced protein ARG7
trEMBL	tr\|A0A068TKX1\|A0A068TKX1_COFCA	5E-43	Coffea canephora DH200=94 genomic scaffold, scaffold_1 {ECO:0000313\|EMBL:CDO96970.1}
TAIR10	AT4G38840.1	4E-28	SAUR-like auxin-responsive protein family

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000005	gene	18726281	18726568	+
GWHAAZE00000005	mRNA	18726281	18726568	+
GWHAAZE00000005	exon	18726281	18726568	+
GWHAAZE00000005	CDS	18726281	18726568	+

Transcript Sequence
>GWHTAAZE018402 ATGGCTATCCATATGCCTCGTATTATTCATGCTAAGAAATTTCTTAGAACGTCTTCATCTACGGCTGCTTCAACCACTTTAGATGTCCCAAAGGGATATTTTGTAGTTTATGTTGGAGAGGAGGTAAAGAAGCGATTTGTCATTCCAATATCTTTCTTGAACCAGCCTTCGTTTCAAGATCTTTTAAGTCAAGCCGAGGAAGAATTCGGGTTTTATCATCCGATGGGTGGTCTCACAATTCCTTGCACTGAGGACATATTCATTAATCTTACTTCTCGCTTGAGTTGA

Network for GWHGAAZE018380

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF02519.15	Auxin_inducible	16	93	7.20E-24

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K14488	SAUR	Plant hormone signal transduction	map04075

Gene Ontology

GO term	Ontology	Name
GO:0009733	biological_process	response to auxin

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	14.132
	SRR3591706	second leaf	6.878
	SRR3591707	mature leaf	0.077
	SRR3591708	Shoot apex	2.997
	SRR3591709	Stem	2.353
	SRR3591710	White floral bud	12.975
	SRR3591711	White flower	18.215
	SRR3591712	Green floral bud	2.926
	SRR3591713	Yellow flower	3.737
SRP173429	SRR8316895	Juvenile bud stage	0.000
	SRR8316896	Juvenile bud stage	0.469
	SRR8316897	Juvenile bud stage	0.000
	SRR8316894	Third green stage	0.723
	SRR8316900	Third green stage	4.677
	SRR8316901	Third green stage	4.680
	SRR8316898	Complete white stage	27.259
	SRR8316899	Complete white stage	3.855
	SRR8316903	Complete white stage	32.291
	SRR8316902	Silver flowering stage	17.733
	SRR8316904	Silver flowering stage	33.584
	SRR8316905	Silver flowering stage	24.330
	SRR8316906	Gold flowering stage	59.180
	SRR8316907	Gold flowering stage	29.840
	SRR8316908	Gold flowering stage	28.686
SRP132670	SRR6706286	Control	0.054
	SRR6706287	Light intensity 50%	0.358
	SRR6706288	Light intensity 20%	0.169
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	2.781
	CNS0095593	Slightly white alabastrum(diploid) 2	8.756
	CNS0095594	Slightly white alabastrum(diploid) 3	1.050
	CNS0095595	Whole white alabastrum(diploid) 2	7.034
	CNS0095596	Whole white alabastrum(diploid) 3	10.722
	CNS0095597	Whole white alabastrum(diploid) 4	6.339
	CNS0095598	Silvery flower (diploied) 1	15.785
	CNS0095599	Silvery flower (diploied) 2	29.502
	CNS0095600	Silvery flower (diploied) 3	41.170
	CNS0095601	Golden flower (diploid) 1	17.360
	CNS0095602	Golden flower (diploid) 2	20.198
	CNS0095603	Golden flower (diploid) 3	20.975
	CNS0095604	Slightly white alabastrum(tetraploid) 1	2.096
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.725
	CNS0095606	Slightly white alabastrum(tetraploid) 3	4.620
	CNS0095607	Whole white alabastrum(tetraploid) 1	5.157
	CNS0095608	Whole white alabastrum(tetraploid) 2	6.236
	CNS0095609	Whole white alabastrum(tetraploid) 3	2.699
	CNS0095610	Silvery flower (tetraploid) 1	26.602
	CNS0095611	Silvery flower (tetraploid) 2	50.910
	CNS0095612	Silvery flower (tetraploid) 3	5.267
	CNS0095613	Golden flower (tetraploid) 1	39.443
	CNS0095614	Golden flower (tetraploid) 2	26.000
	CNS0095615	Golden flower (tetraploid) 3	195.065
CRA001975	CRR073297	Stem 1	0.477
	CRR073298	Stem 2	0.477
	CRR073299	Stem 3	0.111
	CRR073300	Leaf 1	0.214
	CRR073301	Leaf 2	1.121
	CRR073302	Leaf 3	0.052
	CRR073303	Juvenile bud 1	0.377
	CRR073304	Juvenile bud 2	1.256
	CRR073305	Juvenile bud 3	0.567
	CRR073306	Third green 1	2.118
	CRR073307	Third green 2	5.286
	CRR073308	Third green 3	4.017
	CRR073309	Second white 1	1.853
	CRR073310	Second white 2	3.139
	CRR073311	Second white 3	0.185
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	0.000
	CRR073316	Gold flowering 2	0.000
	CRR073317	Gold flowering 3	0.039
	CRR073318	Tawny withering 1	0.000
	CRR073319	Tawny withering 2	0.000
	CRR073320	Tawny withering 3	0.000