Gene detail

Detail information of GWHGAAZE018383

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	CDO96969.1	6.1613E-44	unnamed protein product [Coffea canephora]
Swissprot	tr\|P33079\|A10A5_SOYBN	2E-34	Auxin-induced protein 10A5
trEMBL	tr\|A0A068TLZ9\|A0A068TLZ9_COFCA	2E-44	Coffea canephora DH200=94 genomic scaffold, scaffold_1 {ECO:0000313\|EMBL:CDO96969.1}
TAIR10	AT4G38840.1	3E-28	SAUR-like auxin-responsive protein family

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000005	gene	18740000	18740287	+
GWHAAZE00000005	mRNA	18740000	18740287	+
GWHAAZE00000005	exon	18740000	18740287	+
GWHAAZE00000005	CDS	18740000	18740287	+

Transcript Sequence
>GWHTAAZE018405 ATGGGTATCCGTATGCCTCGTATTATTCAAGCTAAGCAAGTTCTTCGAAGGTTTTCCTTTACAGCAGCTTCAACAGCTGTAGATGTCCCAAAGGGCTATTTTACAGTTTATGTTGGAGAGCAAGAAAAGAAGAGATTTGTAGTTCCGATATCATTCCTGAAAGAGCCTTCATTCCGAGACTTGTTAAGTCAAGCCGAGGAAGAATTTGGGTTTGATCACCCAATGGGTGGTCTCACTATTCCTTGCAAACAAGACTTTTTCACTAACATCACTTCTCATTTGAGATAA

Network for GWHGAAZE018383

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF02519.15	Auxin_inducible	19	92	2.00E-24

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K14488	SAUR	Plant hormone signal transduction	map04075

Gene Ontology

GO term	Ontology	Name
GO:0009733	biological_process	response to auxin

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	30.949
	SRR3591706	second leaf	20.010
	SRR3591707	mature leaf	1.560
	SRR3591708	Shoot apex	15.439
	SRR3591709	Stem	3.735
	SRR3591710	White floral bud	30.023
	SRR3591711	White flower	13.111
	SRR3591712	Green floral bud	21.909
	SRR3591713	Yellow flower	0.414
SRP173429	SRR8316895	Juvenile bud stage	11.948
	SRR8316896	Juvenile bud stage	34.786
	SRR8316897	Juvenile bud stage	7.070
	SRR8316894	Third green stage	7.368
	SRR8316900	Third green stage	35.802
	SRR8316901	Third green stage	34.027
	SRR8316898	Complete white stage	55.133
	SRR8316899	Complete white stage	38.194
	SRR8316903	Complete white stage	67.933
	SRR8316902	Silver flowering stage	22.921
	SRR8316904	Silver flowering stage	39.738
	SRR8316905	Silver flowering stage	25.332
	SRR8316906	Gold flowering stage	32.668
	SRR8316907	Gold flowering stage	30.633
	SRR8316908	Gold flowering stage	19.378
SRP132670	SRR6706286	Control	1.561
	SRR6706287	Light intensity 50%	2.270
	SRR6706288	Light intensity 20%	2.668
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	32.796
	CNS0095593	Slightly white alabastrum(diploid) 2	34.714
	CNS0095594	Slightly white alabastrum(diploid) 3	15.391
	CNS0095595	Whole white alabastrum(diploid) 2	34.155
	CNS0095596	Whole white alabastrum(diploid) 3	50.526
	CNS0095597	Whole white alabastrum(diploid) 4	43.041
	CNS0095598	Silvery flower (diploied) 1	16.731
	CNS0095599	Silvery flower (diploied) 2	50.360
	CNS0095600	Silvery flower (diploied) 3	49.165
	CNS0095601	Golden flower (diploid) 1	16.340
	CNS0095602	Golden flower (diploid) 2	14.787
	CNS0095603	Golden flower (diploid) 3	14.982
	CNS0095604	Slightly white alabastrum(tetraploid) 1	32.011
	CNS0095605	Slightly white alabastrum(tetraploid) 2	31.884
	CNS0095606	Slightly white alabastrum(tetraploid) 3	55.997
	CNS0095607	Whole white alabastrum(tetraploid) 1	29.851
	CNS0095608	Whole white alabastrum(tetraploid) 2	31.406
	CNS0095609	Whole white alabastrum(tetraploid) 3	17.965
	CNS0095610	Silvery flower (tetraploid) 1	21.024
	CNS0095611	Silvery flower (tetraploid) 2	43.410
	CNS0095612	Silvery flower (tetraploid) 3	5.175
	CNS0095613	Golden flower (tetraploid) 1	12.636
	CNS0095614	Golden flower (tetraploid) 2	12.661
	CNS0095615	Golden flower (tetraploid) 3	51.790
CRA001975	CRR073297	Stem 1	8.221
	CRR073298	Stem 2	6.697
	CRR073299	Stem 3	5.187
	CRR073300	Leaf 1	5.534
	CRR073301	Leaf 2	7.277
	CRR073302	Leaf 3	5.647
	CRR073303	Juvenile bud 1	6.314
	CRR073304	Juvenile bud 2	1.830
	CRR073305	Juvenile bud 3	4.882
	CRR073306	Third green 1	2.732
	CRR073307	Third green 2	8.748
	CRR073308	Third green 3	4.950
	CRR073309	Second white 1	1.382
	CRR073310	Second white 2	0.984
	CRR073311	Second white 3	0.006
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	0.456
	CRR073316	Gold flowering 2	0.178
	CRR073317	Gold flowering 3	0.000
	CRR073318	Tawny withering 1	0.510
	CRR073319	Tawny withering 2	0.109
	CRR073320	Tawny withering 3	0.000