Gene detail

Detail information of GWHGAAZE018394

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_008444773.1	2.2412E-108	PREDICTED: V-type proton ATPase 16 kDa proteolipid subunit [Cucumis melo]
Swissprot	tr\|Q96473\|VATL_KALDA	1E-110	V-type proton ATPase 16 kDa proteolipid subunit
trEMBL	tr\|C8CHS0\|C8CHS0_9CARY	8E-109	V-H+-ATPase subunit c protein {ECO:0000313\|EMBL:ACU87545.1}
TAIR10	AT1G19910.1	2E-58	ATPase, F0/V0 complex, subunit C protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000005	gene	18901478	18904948	+
GWHAAZE00000005	mRNA	18901478	18904948	+
GWHAAZE00000005	exon	18901478	18901556	+
GWHAAZE00000005	exon	18901941	18902226	+
GWHAAZE00000005	exon	18904816	18904948	+
GWHAAZE00000005	CDS	18901478	18901556	+
GWHAAZE00000005	CDS	18901941	18902226	+
GWHAAZE00000005	CDS	18904816	18904948	+

Transcript Sequence
>GWHTAAZE018416 ATGTCTTCAGTATTCAGCGGCGATGAAACTGCACCGTTCTTCGGCTTCCTCGGCGCTGCGGCTGCCCTCGTTTTCTCCTGTATGGGAGCTGCGTATGGTACTGCAAAGAGTGGTGTAGGAGTAGCGTCGATGGGGGTGATGAGGCCCGAGCTGGTGATGAAGTCTATTGTGCCGGTTGTTATGGCTGGTGTGTTGGGTATTTATGGCTTGATTATTGCTGTTATCATTAGTACAGGTATTAACCCTAAGGCCAAGTCGTATTACCTTTTTGATGGCTACGCTCATCTTTCCTCCGGTCTCGCTTGTGGTCTTGCTGGCCTTTCTGCTGGAATGGCAATTGGAATTGTTGGCGATGCTGGTGTTAGAGCTAATGCACAGCAGCCAAAGCTTTTTGTTGGAATGATCCTTATTCTTATCTTTGCTGAAGCTCTTGCACTGTACGGCCTCATTGTTGGTATTATCTTGTCTTCACGAGCTGGCCAATCAAGAGCTGACTAA

Network for GWHGAAZE018394

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00137.22	ATP-synt_C	17	76	8.70E-14
PF00137.22	ATP-synt_C	97	155	2.60E-20

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K02155	ATPeV0C, ATP6L	Metabolic pathways	map01100
		Oxidative phosphorylation	map00190
		Phagosome	map04145
		Lysosome	map04142
		Collecting duct acid secretion	map04966
		Synaptic vesicle cycle	map04721

Gene Ontology

GO term	Ontology	Name
GO:1902600	biological_process	proton transmembrane transport
GO:0033179	cellular_component	proton-transporting V-type ATPase, V0 domain
GO:0033177	cellular_component	proton-transporting two-sector ATPase complex, proton-transporting domain
GO:0015078	molecular_function	proton transmembrane transporter activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	487.882
	SRR3591706	second leaf	239.891
	SRR3591707	mature leaf	131.569
	SRR3591708	Shoot apex	312.494
	SRR3591709	Stem	279.851
	SRR3591710	White floral bud	314.815
	SRR3591711	White flower	329.798
	SRR3591712	Green floral bud	329.602
	SRR3591713	Yellow flower	270.387
SRP173429	SRR8316895	Juvenile bud stage	219.213
	SRR8316896	Juvenile bud stage	278.840
	SRR8316897	Juvenile bud stage	145.130
	SRR8316894	Third green stage	124.804
	SRR8316900	Third green stage	444.252
	SRR8316901	Third green stage	395.609
	SRR8316898	Complete white stage	280.817
	SRR8316899	Complete white stage	515.958
	SRR8316903	Complete white stage	361.559
	SRR8316902	Silver flowering stage	346.571
	SRR8316904	Silver flowering stage	390.616
	SRR8316905	Silver flowering stage	222.597
	SRR8316906	Gold flowering stage	566.359
	SRR8316907	Gold flowering stage	641.165
	SRR8316908	Gold flowering stage	613.045
SRP132670	SRR6706286	Control	271.803
	SRR6706287	Light intensity 50%	278.689
	SRR6706288	Light intensity 20%	298.446
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	368.191
	CNS0095593	Slightly white alabastrum(diploid) 2	418.464
	CNS0095594	Slightly white alabastrum(diploid) 3	340.591
	CNS0095595	Whole white alabastrum(diploid) 2	366.921
	CNS0095596	Whole white alabastrum(diploid) 3	404.787
	CNS0095597	Whole white alabastrum(diploid) 4	327.324
	CNS0095598	Silvery flower (diploied) 1	298.143
	CNS0095599	Silvery flower (diploied) 2	316.162
	CNS0095600	Silvery flower (diploied) 3	526.701
	CNS0095601	Golden flower (diploid) 1	259.232
	CNS0095602	Golden flower (diploid) 2	442.175
	CNS0095603	Golden flower (diploid) 3	425.409
	CNS0095604	Slightly white alabastrum(tetraploid) 1	454.983
	CNS0095605	Slightly white alabastrum(tetraploid) 2	424.839
	CNS0095606	Slightly white alabastrum(tetraploid) 3	585.232
	CNS0095607	Whole white alabastrum(tetraploid) 1	371.562
	CNS0095608	Whole white alabastrum(tetraploid) 2	368.167
	CNS0095609	Whole white alabastrum(tetraploid) 3	461.037
	CNS0095610	Silvery flower (tetraploid) 1	517.919
	CNS0095611	Silvery flower (tetraploid) 2	406.135
	CNS0095612	Silvery flower (tetraploid) 3	471.216
	CNS0095613	Golden flower (tetraploid) 1	366.508
	CNS0095614	Golden flower (tetraploid) 2	456.497
	CNS0095615	Golden flower (tetraploid) 3	396.170
CRA001975	CRR073297	Stem 1	312.963
	CRR073298	Stem 2	317.123
	CRR073299	Stem 3	406.889
	CRR073300	Leaf 1	378.517
	CRR073301	Leaf 2	376.865
	CRR073302	Leaf 3	589.631
	CRR073303	Juvenile bud 1	512.361
	CRR073304	Juvenile bud 2	487.851
	CRR073305	Juvenile bud 3	414.276
	CRR073306	Third green 1	546.492
	CRR073307	Third green 2	608.335
	CRR073308	Third green 3	510.356
	CRR073309	Second white 1	574.559
	CRR073310	Second white 2	357.925
	CRR073311	Second white 3	303.126
	CRR073312	Silver flowering 1	424.859
	CRR073313	Silver flowering 2	579.167
	CRR073314	Silver flowering 3	406.601
	CRR073315	Gold flowering 1	160.994
	CRR073316	Gold flowering 2	158.128
	CRR073317	Gold flowering 3	182.169
	CRR073318	Tawny withering 1	402.964
	CRR073319	Tawny withering 2	311.878
	CRR073320	Tawny withering 3	340.683