Gene detail

Detail information of GWHGAAZE018445

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	CDO97051.1	1.60997E-85	unnamed protein product [Coffea canephora]
Swissprot	tr\|Q8VZ37\|AP3S_ARATH	5E-83	AP-3 complex subunit sigma
trEMBL	tr\|A0A068TLD4\|A0A068TLD4_COFCA	6E-86	Coffea canephora DH200=94 genomic scaffold, scaffold_1 {ECO:0000313\|EMBL:CDO97051.1}
TAIR10	AT3G50860.1	7E-66	Clathrin adaptor complex small chain family protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000005	gene	19671135	19673880	-
GWHAAZE00000005	mRNA	19671135	19673880	-
GWHAAZE00000005	exon	19671135	19671290	-
GWHAAZE00000005	exon	19671995	19672065	-
GWHAAZE00000005	exon	19672788	19672884	-
GWHAAZE00000005	exon	19673180	19673241	-
GWHAAZE00000005	exon	19673689	19673731	-
GWHAAZE00000005	exon	19673812	19673880	-
GWHAAZE00000005	CDS	19673812	19673880	-
GWHAAZE00000005	CDS	19673689	19673731	-
GWHAAZE00000005	CDS	19673180	19673241	-
GWHAAZE00000005	CDS	19672788	19672884	-
GWHAAZE00000005	CDS	19671995	19672065	-
GWHAAZE00000005	CDS	19671135	19671290	-

Transcript Sequence
>GWHTAAZE018467 ATGATACGAGCGGTAATAGTGATGAACGATCAAGGCAAGCCTCGCCTTGTCAAATTCTACGATTATCAGCCCGTGGAGAAGCAGCAAGACCTGATTCGAAGGTTATATGGAGTTCTATGCAGTAGACCTGAGAATGTGAGCAATTTCGTTCAAGCCGATTCAATCTTTGGACCAGATTCTCGGCTTGTATACAAAACTTATGCTACATTGTACTTTGTCTTCTTGTTTGACGCTTCAGAAAATGAACTGGCAATCCTGGATCTCATGCAAGTGTTTGTGGAGACTTTGGACAAGTGTTTCAGTAATGTGTGTGAGCTCGACATAGTCTTTAATTTTAACAAGGTGCATACTATTTTAGATGAGCTTATTTTGGGAGGCCAGGTTCTCGAGACAAATTCTTCAGAAATTGTTAAAGCAGTTGAAGAAATTTCTAGGTTCTCTCTCTCTCTCCCTCCTCAACACGTGTTTGGACTTCAGTGCCAAGTGGTTTTCGGTTGA

Network for GWHGAAZE018445

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF01217.21	Clat_adaptor_s	1	144	2.00E-49

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K12399	AP3S	Lysosome	map04142

Gene Ontology

GO term	Ontology	Name
GO:0006886	biological_process	intracellular protein transport
GO:0016192	biological_process	vesicle-mediated transport
GO:0015031	biological_process	protein transport
GO:0030117	cellular_component	membrane coat

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	20.151
	SRR3591706	second leaf	8.733
	SRR3591707	mature leaf	7.485
	SRR3591708	Shoot apex	16.276
	SRR3591709	Stem	20.590
	SRR3591710	White floral bud	15.223
	SRR3591711	White flower	13.191
	SRR3591712	Green floral bud	19.295
	SRR3591713	Yellow flower	14.523
SRP173429	SRR8316895	Juvenile bud stage	9.196
	SRR8316896	Juvenile bud stage	15.784
	SRR8316897	Juvenile bud stage	6.655
	SRR8316894	Third green stage	8.464
	SRR8316900	Third green stage	20.672
	SRR8316901	Third green stage	17.819
	SRR8316898	Complete white stage	7.239
	SRR8316899	Complete white stage	21.527
	SRR8316903	Complete white stage	12.286
	SRR8316902	Silver flowering stage	8.326
	SRR8316904	Silver flowering stage	10.684
	SRR8316905	Silver flowering stage	4.702
	SRR8316906	Gold flowering stage	14.614
	SRR8316907	Gold flowering stage	12.355
	SRR8316908	Gold flowering stage	11.608
SRP132670	SRR6706286	Control	13.118
	SRR6706287	Light intensity 50%	12.593
	SRR6706288	Light intensity 20%	13.797
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	15.212
	CNS0095593	Slightly white alabastrum(diploid) 2	14.453
	CNS0095594	Slightly white alabastrum(diploid) 3	11.411
	CNS0095595	Whole white alabastrum(diploid) 2	14.203
	CNS0095596	Whole white alabastrum(diploid) 3	11.704
	CNS0095597	Whole white alabastrum(diploid) 4	9.618
	CNS0095598	Silvery flower (diploied) 1	10.978
	CNS0095599	Silvery flower (diploied) 2	12.346
	CNS0095600	Silvery flower (diploied) 3	16.201
	CNS0095601	Golden flower (diploid) 1	8.427
	CNS0095602	Golden flower (diploid) 2	11.390
	CNS0095603	Golden flower (diploid) 3	12.648
	CNS0095604	Slightly white alabastrum(tetraploid) 1	17.356
	CNS0095605	Slightly white alabastrum(tetraploid) 2	17.060
	CNS0095606	Slightly white alabastrum(tetraploid) 3	14.565
	CNS0095607	Whole white alabastrum(tetraploid) 1	12.521
	CNS0095608	Whole white alabastrum(tetraploid) 2	12.035
	CNS0095609	Whole white alabastrum(tetraploid) 3	15.859
	CNS0095610	Silvery flower (tetraploid) 1	17.254
	CNS0095611	Silvery flower (tetraploid) 2	14.306
	CNS0095612	Silvery flower (tetraploid) 3	13.657
	CNS0095613	Golden flower (tetraploid) 1	8.991
	CNS0095614	Golden flower (tetraploid) 2	12.716
	CNS0095615	Golden flower (tetraploid) 3	10.288
CRA001975	CRR073297	Stem 1	13.902
	CRR073298	Stem 2	13.554
	CRR073299	Stem 3	12.077
	CRR073300	Leaf 1	12.527
	CRR073301	Leaf 2	13.874
	CRR073302	Leaf 3	12.643
	CRR073303	Juvenile bud 1	14.159
	CRR073304	Juvenile bud 2	9.249
	CRR073305	Juvenile bud 3	13.344
	CRR073306	Third green 1	3.379
	CRR073307	Third green 2	5.922
	CRR073308	Third green 3	3.724
	CRR073309	Second white 1	7.596
	CRR073310	Second white 2	6.409
	CRR073311	Second white 3	5.507
	CRR073312	Silver flowering 1	4.814
	CRR073313	Silver flowering 2	4.690
	CRR073314	Silver flowering 3	2.389
	CRR073315	Gold flowering 1	5.901
	CRR073316	Gold flowering 2	5.774
	CRR073317	Gold flowering 3	3.358
	CRR073318	Tawny withering 1	11.451
	CRR073319	Tawny withering 2	10.708
	CRR073320	Tawny withering 3	14.192