Gene detail

Detail information of GWHGAAZE018557

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_011089620.1	3.01534E-98	PREDICTED: 40S ribosomal protein S16 [Sesamum indicum]
Swissprot	tr\|O22647\|RS16_FRIAG	5E-94	40S ribosomal protein S16
trEMBL	tr\|A0A068TMQ9\|A0A068TMQ9_COFCA	5E-97	Coffea canephora DH200=94 genomic scaffold, scaffold_1 {ECO:0000313\|EMBL:CDO97194.1}
TAIR10	AT5G18380.1	4E-72	Ribosomal protein S5 domain 2-like superfamily protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000005	gene	21117486	21117920	+
GWHAAZE00000005	mRNA	21117486	21117920	+
GWHAAZE00000005	exon	21117486	21117920	+
GWHAAZE00000005	CDS	21117486	21117920	+

Transcript Sequence
>GWHTAAZE018579 ATGACGACACCGACGGAGTCCGTTCAATGCTTCGGCCGTAAGAAAACCGCCGTCGCTGTTACTCACTGCAAGCGCGGCCGCGGACTAATTAAGATCAACGGCGTTCCGATCGAGCTCGTGGAGCCGGAGATCCTCCGGTACAAGGCCTTCGAGCCAGTACTCCTCCTCGGCCGCCACAGGTTCGCAGGCGTCGACATGAGGATTCGTGTCAAAGGCGGTGGACATACCTCTCAGATCTACGCCATCAGGCAGAGCATTGCTAAAGCACTCGTTGCTTACTACCAGAAGTATGTTGATGAACAGTCCAAAAAGGAGATCAAGGATATCCTTGTGAGGTACGATCGGACTTTGCTTGTTGCTGATCCTAGACGTTGCGAGCCTAAGAAGTTTGGTGGTCGCGGTGCTCGTGCTAGGTTCCAGAAATCTTACCGTTAA

Network for GWHGAAZE018557

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00380.20	Ribosomal_S9	12	144	1.10E-31

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K02960	RP-S16e, RPS16	Ribosome	map03010

Gene Ontology

GO term	Ontology	Name
GO:0006412	biological_process	translation
GO:0005840	cellular_component	ribosome
GO:0003735	molecular_function	structural constituent of ribosome

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	161.360
	SRR3591706	second leaf	89.563
	SRR3591707	mature leaf	61.657
	SRR3591708	Shoot apex	202.747
	SRR3591709	Stem	108.936
	SRR3591710	White floral bud	100.425
	SRR3591711	White flower	113.917
	SRR3591712	Green floral bud	171.251
	SRR3591713	Yellow flower	86.288
SRP173429	SRR8316895	Juvenile bud stage	100.806
	SRR8316896	Juvenile bud stage	159.944
	SRR8316897	Juvenile bud stage	60.728
	SRR8316894	Third green stage	70.908
	SRR8316900	Third green stage	235.388
	SRR8316901	Third green stage	223.992
	SRR8316898	Complete white stage	63.257
	SRR8316899	Complete white stage	208.952
	SRR8316903	Complete white stage	92.419
	SRR8316902	Silver flowering stage	61.209
	SRR8316904	Silver flowering stage	48.518
	SRR8316905	Silver flowering stage	26.977
	SRR8316906	Gold flowering stage	86.472
	SRR8316907	Gold flowering stage	91.501
	SRR8316908	Gold flowering stage	92.620
SRP132670	SRR6706286	Control	197.959
	SRR6706287	Light intensity 50%	194.335
	SRR6706288	Light intensity 20%	214.084
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	231.436
	CNS0095593	Slightly white alabastrum(diploid) 2	287.454
	CNS0095594	Slightly white alabastrum(diploid) 3	236.534
	CNS0095595	Whole white alabastrum(diploid) 2	231.274
	CNS0095596	Whole white alabastrum(diploid) 3	269.863
	CNS0095597	Whole white alabastrum(diploid) 4	173.638
	CNS0095598	Silvery flower (diploied) 1	143.794
	CNS0095599	Silvery flower (diploied) 2	136.179
	CNS0095600	Silvery flower (diploied) 3	133.382
	CNS0095601	Golden flower (diploid) 1	127.011
	CNS0095602	Golden flower (diploid) 2	122.009
	CNS0095603	Golden flower (diploid) 3	125.791
	CNS0095604	Slightly white alabastrum(tetraploid) 1	179.855
	CNS0095605	Slightly white alabastrum(tetraploid) 2	176.186
	CNS0095606	Slightly white alabastrum(tetraploid) 3	184.941
	CNS0095607	Whole white alabastrum(tetraploid) 1	107.401
	CNS0095608	Whole white alabastrum(tetraploid) 2	92.760
	CNS0095609	Whole white alabastrum(tetraploid) 3	132.675
	CNS0095610	Silvery flower (tetraploid) 1	102.970
	CNS0095611	Silvery flower (tetraploid) 2	91.969
	CNS0095612	Silvery flower (tetraploid) 3	74.912
	CNS0095613	Golden flower (tetraploid) 1	70.057
	CNS0095614	Golden flower (tetraploid) 2	89.688
	CNS0095615	Golden flower (tetraploid) 3	66.038
CRA001975	CRR073297	Stem 1	229.316
	CRR073298	Stem 2	242.270
	CRR073299	Stem 3	336.027
	CRR073300	Leaf 1	259.808
	CRR073301	Leaf 2	287.101
	CRR073302	Leaf 3	447.153
	CRR073303	Juvenile bud 1	329.770
	CRR073304	Juvenile bud 2	319.947
	CRR073305	Juvenile bud 3	223.248
	CRR073306	Third green 1	106.565
	CRR073307	Third green 2	147.869
	CRR073308	Third green 3	128.632
	CRR073309	Second white 1	92.658
	CRR073310	Second white 2	69.074
	CRR073311	Second white 3	47.572
	CRR073312	Silver flowering 1	57.886
	CRR073313	Silver flowering 2	99.371
	CRR073314	Silver flowering 3	60.208
	CRR073315	Gold flowering 1	120.999
	CRR073316	Gold flowering 2	128.016
	CRR073317	Gold flowering 3	134.846
	CRR073318	Tawny withering 1	260.945
	CRR073319	Tawny withering 2	226.696
	CRR073320	Tawny withering 3	269.236