Gene detail

Detail information of GWHGAAZE018601

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_006346331.1	4.77749E-70	PREDICTED: protein TRI1-like [Solanum tuberosum]
Swissprot	tr\|Q9SIV5\|C3H19_ARATH	0.00000003	Zinc finger CCCH domain-containing protein 19
trEMBL	tr\|M1CFP1\|M1CFP1_SOLTU	2E-70	Uncharacterized protein {ECO:0000313\|EnsemblPlants:PGSC0003DMT400066526}
TAIR10	AT4G34290.1	1E-40	SWIB/MDM2 domain superfamily protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000005	gene	21692883	21696831	+
GWHAAZE00000005	mRNA	21692883	21696831	+
GWHAAZE00000005	exon	21692883	21693179	+
GWHAAZE00000005	exon	21696712	21696831	+
GWHAAZE00000005	CDS	21692883	21693179	+
GWHAAZE00000005	CDS	21696712	21696831	+

Transcript Sequence
>GWHTAAZE018623 ATGGCGATTTCTTTGGGGATTTTCTCTTCCTTCTTGGCCGGCGAAACAGCAGTATTCTCCAAGTCATCATCGTCTCTAAGATTTCTTCCTCCTGCTAACGTGCGCACTGTGCGCACAGTCACCTTCGCCGCCGCCTCTAAGCCGGCGACGGAGGATAAGAAGAGGGAGCCAAGAGGCATAATGAAGCCCCGCCGCGTGTCCCCTGAAATGCAAGCCTTCCTCGGCGGCGTGCCGGAGATTCCTCGCACTCAGGCCCTCAAAGAGATTTGGGCTTATATCAAGCAGCAAAACCTTCAGGACCCTGAAAACAAGAAGATCATTGTTTGTGATGAGAAGCTGAAGTCAATATTTGCTGGGAAGGAACGAGTGGGATTTCTCGAGATCGCAGGGTTAATTTCACCTCACTTCCTCAAGTGA

Network for GWHGAAZE018601

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF02201.19	SWIB	62	136	3.30E-28

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	SWI/SNF-BAF60b

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0005515	molecular_function	protein binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	123.937
	SRR3591706	second leaf	85.079
	SRR3591707	mature leaf	66.081
	SRR3591708	Shoot apex	181.876
	SRR3591709	Stem	59.814
	SRR3591710	White floral bud	66.264
	SRR3591711	White flower	101.482
	SRR3591712	Green floral bud	95.623
	SRR3591713	Yellow flower	75.137
SRP173429	SRR8316895	Juvenile bud stage	73.948
	SRR8316896	Juvenile bud stage	88.972
	SRR8316897	Juvenile bud stage	48.421
	SRR8316894	Third green stage	35.548
	SRR8316900	Third green stage	114.596
	SRR8316901	Third green stage	103.201
	SRR8316898	Complete white stage	32.425
	SRR8316899	Complete white stage	87.528
	SRR8316903	Complete white stage	52.268
	SRR8316902	Silver flowering stage	30.720
	SRR8316904	Silver flowering stage	32.093
	SRR8316905	Silver flowering stage	19.382
	SRR8316906	Gold flowering stage	49.705
	SRR8316907	Gold flowering stage	51.197
	SRR8316908	Gold flowering stage	68.742
SRP132670	SRR6706286	Control	117.940
	SRR6706287	Light intensity 50%	114.637
	SRR6706288	Light intensity 20%	123.593
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	98.045
	CNS0095593	Slightly white alabastrum(diploid) 2	99.197
	CNS0095594	Slightly white alabastrum(diploid) 3	70.802
	CNS0095595	Whole white alabastrum(diploid) 2	74.695
	CNS0095596	Whole white alabastrum(diploid) 3	81.100
	CNS0095597	Whole white alabastrum(diploid) 4	51.220
	CNS0095598	Silvery flower (diploied) 1	93.255
	CNS0095599	Silvery flower (diploied) 2	86.073
	CNS0095600	Silvery flower (diploied) 3	82.461
	CNS0095601	Golden flower (diploid) 1	96.128
	CNS0095602	Golden flower (diploid) 2	101.522
	CNS0095603	Golden flower (diploid) 3	96.052
	CNS0095604	Slightly white alabastrum(tetraploid) 1	77.947
	CNS0095605	Slightly white alabastrum(tetraploid) 2	76.414
	CNS0095606	Slightly white alabastrum(tetraploid) 3	114.241
	CNS0095607	Whole white alabastrum(tetraploid) 1	43.965
	CNS0095608	Whole white alabastrum(tetraploid) 2	40.414
	CNS0095609	Whole white alabastrum(tetraploid) 3	101.502
	CNS0095610	Silvery flower (tetraploid) 1	81.865
	CNS0095611	Silvery flower (tetraploid) 2	94.109
	CNS0095612	Silvery flower (tetraploid) 3	58.402
	CNS0095613	Golden flower (tetraploid) 1	54.698
	CNS0095614	Golden flower (tetraploid) 2	77.595
	CNS0095615	Golden flower (tetraploid) 3	62.621
CRA001975	CRR073297	Stem 1	101.329
	CRR073298	Stem 2	100.605
	CRR073299	Stem 3	136.994
	CRR073300	Leaf 1	73.958
	CRR073301	Leaf 2	99.525
	CRR073302	Leaf 3	130.079
	CRR073303	Juvenile bud 1	82.701
	CRR073304	Juvenile bud 2	88.463
	CRR073305	Juvenile bud 3	80.849
	CRR073306	Third green 1	36.027
	CRR073307	Third green 2	34.889
	CRR073308	Third green 3	35.986
	CRR073309	Second white 1	65.574
	CRR073310	Second white 2	36.545
	CRR073311	Second white 3	27.482
	CRR073312	Silver flowering 1	41.574
	CRR073313	Silver flowering 2	55.852
	CRR073314	Silver flowering 3	42.671
	CRR073315	Gold flowering 1	96.413
	CRR073316	Gold flowering 2	107.609
	CRR073317	Gold flowering 3	120.670
	CRR073318	Tawny withering 1	100.411
	CRR073319	Tawny withering 2	83.718
	CRR073320	Tawny withering 3	109.320