Gene detail

Detail information of GWHGAAZE018627

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_007042657.1	1.26205E-73	GATA type zinc finger transcription factor family protein [Theobroma cacao]
Swissprot	tr\|Q94JX5\|WLIM1_ARATH	4E-68	LIM domain-containing protein WLIM1 {ECO:0000305}
trEMBL	tr\|A0A061E875\|A0A061E875_THECC	5E-74	GATA type zinc finger transcription factor family protein {ECO:0000313\|EMBL:EOX98488.1}
TAIR10	AT1G10200.1	1E-54	GATA type zinc finger transcription factor family protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000005	gene	21943768	21945375	+
GWHAAZE00000005	mRNA	21943768	21945375	+
GWHAAZE00000005	exon	21943768	21943902	+
GWHAAZE00000005	exon	21944812	21944901	+
GWHAAZE00000005	exon	21945136	21945375	+
GWHAAZE00000005	CDS	21943768	21943902	+
GWHAAZE00000005	CDS	21944812	21944901	+
GWHAAZE00000005	CDS	21945136	21945375	+

Transcript Sequence
>GWHTAAZE018649 ATGGGTTTTGGAGGAACAACTCAAAAGTGCATGGCCTGCGAAAAGACGGTCTATCTGGTCGATCGTTTGGCAGCCGATAACCGCATTTACCACAAAGCCTGCTTCCGATGCCACCACTGCAAAAGCACCCTTAAGAATGCTAACGCAAGCAAAGTCGTGAGTCTCTTTGGGGGCACAAGGGAAAAATGCGTGGGGTGCAATAAGACCGTTTATCCAATCGAAAAGGTAACTGTGAATGGAAACGCATATCACAGAGTATGCTTCAAGTGTACCCATGGAGGATGCACAATAAGCCCATCAAACTACATAGCACATGAAGGAAGATTGTACTGCAAGCACCATCACATTCAACTATTCAAGGAGAGAGGGAATTACAGCGCATTGGAGAGTAGTACACCTGCTACTGCTAGTCTAGAAAAGGAGGAGCTACATTCGGCATCAACGGAGGTTGCTGCCGAGTCATGA

Network for GWHGAAZE018627

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00412.23	LIM	10	48	5.00E-07
PF00412.23	LIM	63	118	3.00E-12

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	LIM

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	1.394
	SRR3591706	second leaf	0.000
	SRR3591707	mature leaf	0.193
	SRR3591708	Shoot apex	1.242
	SRR3591709	Stem	5.760
	SRR3591710	White floral bud	977.615
	SRR3591711	White flower	45.914
	SRR3591712	Green floral bud	923.908
	SRR3591713	Yellow flower	39.205
SRP173429	SRR8316895	Juvenile bud stage	44.351
	SRR8316896	Juvenile bud stage	207.921
	SRR8316897	Juvenile bud stage	125.850
	SRR8316894	Third green stage	101.522
	SRR8316900	Third green stage	542.206
	SRR8316901	Third green stage	580.529
	SRR8316898	Complete white stage	0.461
	SRR8316899	Complete white stage	4.793
	SRR8316903	Complete white stage	1.523
	SRR8316902	Silver flowering stage	9.001
	SRR8316904	Silver flowering stage	21.153
	SRR8316905	Silver flowering stage	6.256
	SRR8316906	Gold flowering stage	3.143
	SRR8316907	Gold flowering stage	0.997
	SRR8316908	Gold flowering stage	0.600
SRP132670	SRR6706286	Control	331.129
	SRR6706287	Light intensity 50%	324.912
	SRR6706288	Light intensity 20%	295.770
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	708.870
	CNS0095593	Slightly white alabastrum(diploid) 2	540.130
	CNS0095594	Slightly white alabastrum(diploid) 3	802.908
	CNS0095595	Whole white alabastrum(diploid) 2	1402.380
	CNS0095596	Whole white alabastrum(diploid) 3	1704.643
	CNS0095597	Whole white alabastrum(diploid) 4	1898.767
	CNS0095598	Silvery flower (diploied) 1	54.047
	CNS0095599	Silvery flower (diploied) 2	188.381
	CNS0095600	Silvery flower (diploied) 3	28.167
	CNS0095601	Golden flower (diploid) 1	48.246
	CNS0095602	Golden flower (diploid) 2	23.816
	CNS0095603	Golden flower (diploid) 3	23.411
	CNS0095604	Slightly white alabastrum(tetraploid) 1	1098.517
	CNS0095605	Slightly white alabastrum(tetraploid) 2	1313.479
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.922
	CNS0095607	Whole white alabastrum(tetraploid) 1	2154.915
	CNS0095608	Whole white alabastrum(tetraploid) 2	2489.518
	CNS0095609	Whole white alabastrum(tetraploid) 3	1021.864
	CNS0095610	Silvery flower (tetraploid) 1	26.238
	CNS0095611	Silvery flower (tetraploid) 2	91.553
	CNS0095612	Silvery flower (tetraploid) 3	238.217
	CNS0095613	Golden flower (tetraploid) 1	65.361
	CNS0095614	Golden flower (tetraploid) 2	12.883
	CNS0095615	Golden flower (tetraploid) 3	120.786
CRA001975	CRR073297	Stem 1	100.465
	CRR073298	Stem 2	124.794
	CRR073299	Stem 3	53.435
	CRR073300	Leaf 1	446.605
	CRR073301	Leaf 2	287.436
	CRR073302	Leaf 3	169.513
	CRR073303	Juvenile bud 1	280.296
	CRR073304	Juvenile bud 2	264.818
	CRR073305	Juvenile bud 3	23.349
	CRR073306	Third green 1	115.406
	CRR073307	Third green 2	178.054
	CRR073308	Third green 3	145.094
	CRR073309	Second white 1	4.232
	CRR073310	Second white 2	34.521
	CRR073311	Second white 3	29.719
	CRR073312	Silver flowering 1	106.138
	CRR073313	Silver flowering 2	89.936
	CRR073314	Silver flowering 3	59.894
	CRR073315	Gold flowering 1	157.003
	CRR073316	Gold flowering 2	47.511
	CRR073317	Gold flowering 3	17.700
	CRR073318	Tawny withering 1	150.666
	CRR073319	Tawny withering 2	152.284
	CRR073320	Tawny withering 3	150.998