Gene detail

Detail information of GWHGAAZE018659

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_009616821.1	5.21813E-92	PREDICTED: transcription factor bHLH25-like [Nicotiana tomentosiformis]
Swissprot	tr\|Q9T072\|BH025_ARATH	7E-62	Transcription factor bHLH25
trEMBL	tr\|M1A291\|M1A291_SOLTU	3E-92	Uncharacterized protein {ECO:0000313\|EnsemblPlants:PGSC0003DMT400013074}
TAIR10	AT4G37850.1	2E-51	basic helix-loop-helix (bHLH) DNA-binding superfamily protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000005	gene	22404212	22405419	-
GWHAAZE00000005	mRNA	22404212	22405419	-
GWHAAZE00000005	exon	22405300	22405419	-
GWHAAZE00000005	exon	22404784	22405152	-
GWHAAZE00000005	exon	22404212	22404283	-
GWHAAZE00000005	CDS	22405300	22405419	-
GWHAAZE00000005	CDS	22404784	22405152	-
GWHAAZE00000005	CDS	22404212	22404283	-

Transcript Sequence
>GWHTAAZE018681 ATGAACACAAGCACTAAGCTTCCTCAAGCACAAGATCACATCATAGCTGAGAGAAAGAGGCGAGAAAAGCTTAGCCAGAAATTTATTGCTCTTTCTGCTCTAATCCCTGGCCTAAAGAAGATGGACAAGGCTTCGGTTCTTGGAGATGCTATCAAGTACTTGAAACAACTCCAAGAGCGACTGACTGTGCTTGAGGAGCTAAACAAGAAGTCCACCGAATCAGTGGTTTTCGTGAGGAAATATGAACTACTTGCTGATGGTGAAAATTCTTCTTTGGATGAGGACTCCAGTGGCCTTATCAATGAACCGCTCCCAGAAATCGAAGCAAGATTTTCCGACAAAGATATCCTCATAAGAATCCACTGCGAGAAAAAGAAAGGAGTCCTTGAAAAAACAGTTGCTGAAATAGAGAAATTCCAACTTCTAGTCATTAATAGCAGTGCTGTGACATTTGGGAGTAATGCTCTCGACATAACCATAATTGCTCAGGATAAGGATTTCACCATGACAGCAAAGGATCTAGTGAAGAATCTACGCTCTGCTCTCAAACAATTCATGTAA

Network for GWHGAAZE018659

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00010.27	HLH	11	58	6.80E-11

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	bHLH

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0046983	molecular_function	protein dimerization activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	1.140
	SRR3591706	second leaf	0.333
	SRR3591707	mature leaf	0.211
	SRR3591708	Shoot apex	0.346
	SRR3591709	Stem	0.611
	SRR3591710	White floral bud	0.395
	SRR3591711	White flower	0.406
	SRR3591712	Green floral bud	0.164
	SRR3591713	Yellow flower	1.685
SRP173429	SRR8316895	Juvenile bud stage	0.113
	SRR8316896	Juvenile bud stage	1.399
	SRR8316897	Juvenile bud stage	0.766
	SRR8316894	Third green stage	0.139
	SRR8316900	Third green stage	0.419
	SRR8316901	Third green stage	0.527
	SRR8316898	Complete white stage	0.714
	SRR8316899	Complete white stage	0.225
	SRR8316903	Complete white stage	0.774
	SRR8316902	Silver flowering stage	1.413
	SRR8316904	Silver flowering stage	1.702
	SRR8316905	Silver flowering stage	0.595
	SRR8316906	Gold flowering stage	5.952
	SRR8316907	Gold flowering stage	2.377
	SRR8316908	Gold flowering stage	4.261
SRP132670	SRR6706286	Control	0.000
	SRR6706287	Light intensity 50%	0.000
	SRR6706288	Light intensity 20%	0.000
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	1.024
	CNS0095593	Slightly white alabastrum(diploid) 2	0.693
	CNS0095594	Slightly white alabastrum(diploid) 3	0.967
	CNS0095595	Whole white alabastrum(diploid) 2	0.000
	CNS0095596	Whole white alabastrum(diploid) 3	0.000
	CNS0095597	Whole white alabastrum(diploid) 4	0.310
	CNS0095598	Silvery flower (diploied) 1	0.054
	CNS0095599	Silvery flower (diploied) 2	1.091
	CNS0095600	Silvery flower (diploied) 3	0.430
	CNS0095601	Golden flower (diploid) 1	0.441
	CNS0095602	Golden flower (diploid) 2	1.202
	CNS0095603	Golden flower (diploid) 3	1.437
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.599
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.148
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.128
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.155
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.645
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.335
	CNS0095610	Silvery flower (tetraploid) 1	0.594
	CNS0095611	Silvery flower (tetraploid) 2	0.413
	CNS0095612	Silvery flower (tetraploid) 3	0.331
	CNS0095613	Golden flower (tetraploid) 1	1.030
	CNS0095614	Golden flower (tetraploid) 2	2.460
	CNS0095615	Golden flower (tetraploid) 3	0.409
CRA001975	CRR073297	Stem 1	0.167
	CRR073298	Stem 2	0.790
	CRR073299	Stem 3	0.770
	CRR073300	Leaf 1	0.120
	CRR073301	Leaf 2	0.000
	CRR073302	Leaf 3	0.146
	CRR073303	Juvenile bud 1	0.000
	CRR073304	Juvenile bud 2	0.830
	CRR073305	Juvenile bud 3	0.272
	CRR073306	Third green 1	0.491
	CRR073307	Third green 2	0.071
	CRR073308	Third green 3	0.639
	CRR073309	Second white 1	1.042
	CRR073310	Second white 2	3.260
	CRR073311	Second white 3	2.787
	CRR073312	Silver flowering 1	3.086
	CRR073313	Silver flowering 2	1.765
	CRR073314	Silver flowering 3	0.043
	CRR073315	Gold flowering 1	0.236
	CRR073316	Gold flowering 2	2.508
	CRR073317	Gold flowering 3	0.743
	CRR073318	Tawny withering 1	6.368
	CRR073319	Tawny withering 2	11.757
	CRR073320	Tawny withering 3	3.568