Gene detail

Detail information of GWHGAAZE018701

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_002307338.2	4.12907E-29	hypothetical protein POPTR_0005s17970g [Populus trichocarpa]
Swissprot	tr\|Q8L7S0\|ULP2B_ARATH	2E-25	Probable ubiquitin-like-specific protease 2B
trEMBL	tr\|B9H6V2\|B9H6V2_POPTR	2E-29	Uncharacterized protein {ECO:0000313\|EMBL:EEE94334.2}
TAIR10	AT1G09730.1	1E-22	Cysteine proteinases superfamily protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000005	gene	23025567	23026367	-
GWHAAZE00000005	mRNA	23025567	23026367	-
GWHAAZE00000005	exon	23026333	23026367	-
GWHAAZE00000005	exon	23026042	23026132	-
GWHAAZE00000005	exon	23025567	23025737	-
GWHAAZE00000005	CDS	23026333	23026367	-
GWHAAZE00000005	CDS	23026042	23026132	-
GWHAAZE00000005	CDS	23025567	23025737	-

Transcript Sequence
>GWHTAAZE018723 ATGTCTCAGCTAAATCAAGTGAATTATTATTTACGTTATCTTTTGGAAGAGTGGAGAGAAAGACATAATGGGCCAGAAGAAGACACTTCTTCTAAGTTCTTCAATTTACAGTTTGTCCCTCTTGAGCTACCACAGCAAGAAAACTCATTTGATTGTGGCCTCTTTTTGCTCCATTATGTGGAACTATTTTTGGAACAAGCTCCTGTTAACTTCAGCTATTCCAGAATATCCGGGTTTTCCAAATTTGTAAGTTCTCGTTTCATTCACCATGCTAGCATTGCTCTTGTTTTTCGATAA

Network for GWHGAAZE018701

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF02902.20	Peptidase_C48	5	76	3.60E-10

Protein Sequence

Gene family

Gene family	subfamily
Ubiquitin Family	ULP

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0006508	biological_process	proteolysis
GO:0008234	molecular_function	cysteine-type peptidase activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	8.364
	SRR3591706	second leaf	3.966
	SRR3591707	mature leaf	2.419
	SRR3591708	Shoot apex	9.312
	SRR3591709	Stem	9.544
	SRR3591710	White floral bud	2.158
	SRR3591711	White flower	4.955
	SRR3591712	Green floral bud	4.130
	SRR3591713	Yellow flower	2.967
SRP173429	SRR8316895	Juvenile bud stage	3.270
	SRR8316896	Juvenile bud stage	5.341
	SRR8316897	Juvenile bud stage	2.854
	SRR8316894	Third green stage	2.429
	SRR8316900	Third green stage	4.877
	SRR8316901	Third green stage	4.979
	SRR8316898	Complete white stage	2.141
	SRR8316899	Complete white stage	5.901
	SRR8316903	Complete white stage	2.587
	SRR8316902	Silver flowering stage	2.529
	SRR8316904	Silver flowering stage	2.883
	SRR8316905	Silver flowering stage	1.938
	SRR8316906	Gold flowering stage	3.161
	SRR8316907	Gold flowering stage	2.918
	SRR8316908	Gold flowering stage	4.896
SRP132670	SRR6706286	Control	0.635
	SRR6706287	Light intensity 50%	0.777
	SRR6706288	Light intensity 20%	1.284
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	3.313
	CNS0095593	Slightly white alabastrum(diploid) 2	3.175
	CNS0095594	Slightly white alabastrum(diploid) 3	2.437
	CNS0095595	Whole white alabastrum(diploid) 2	2.738
	CNS0095596	Whole white alabastrum(diploid) 3	1.693
	CNS0095597	Whole white alabastrum(diploid) 4	2.306
	CNS0095598	Silvery flower (diploied) 1	2.291
	CNS0095599	Silvery flower (diploied) 2	1.957
	CNS0095600	Silvery flower (diploied) 3	6.334
	CNS0095601	Golden flower (diploid) 1	4.972
	CNS0095602	Golden flower (diploid) 2	7.620
	CNS0095603	Golden flower (diploid) 3	5.668
	CNS0095604	Slightly white alabastrum(tetraploid) 1	4.167
	CNS0095605	Slightly white alabastrum(tetraploid) 2	3.834
	CNS0095606	Slightly white alabastrum(tetraploid) 3	6.920
	CNS0095607	Whole white alabastrum(tetraploid) 1	2.182
	CNS0095608	Whole white alabastrum(tetraploid) 2	3.966
	CNS0095609	Whole white alabastrum(tetraploid) 3	5.628
	CNS0095610	Silvery flower (tetraploid) 1	6.639
	CNS0095611	Silvery flower (tetraploid) 2	7.773
	CNS0095612	Silvery flower (tetraploid) 3	4.609
	CNS0095613	Golden flower (tetraploid) 1	2.913
	CNS0095614	Golden flower (tetraploid) 2	3.325
	CNS0095615	Golden flower (tetraploid) 3	2.794
CRA001975	CRR073297	Stem 1	1.834
	CRR073298	Stem 2	2.877
	CRR073299	Stem 3	0.883
	CRR073300	Leaf 1	0.752
	CRR073301	Leaf 2	3.485
	CRR073302	Leaf 3	1.973
	CRR073303	Juvenile bud 1	0.490
	CRR073304	Juvenile bud 2	0.613
	CRR073305	Juvenile bud 3	0.598
	CRR073306	Third green 1	0.032
	CRR073307	Third green 2	0.181
	CRR073308	Third green 3	0.330
	CRR073309	Second white 1	0.405
	CRR073310	Second white 2	1.012
	CRR073311	Second white 3	0.894
	CRR073312	Silver flowering 1	0.394
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	0.383
	CRR073316	Gold flowering 2	0.973
	CRR073317	Gold flowering 3	1.080
	CRR073318	Tawny withering 1	1.801
	CRR073319	Tawny withering 2	1.388
	CRR073320	Tawny withering 3	3.604