Gene detail

Detail information of GWHGAAZE018713

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_009617142.1	4.88071E-11	PREDICTED: F-box/kelch-repeat protein At3g06240-like [Nicotiana tomentosiformis]
Swissprot	tr\|Q8GXC7\|FBK50_ARATH	0.0000008	F-box/kelch-repeat protein At3g06240
trEMBL	tr\|A0A068V5X4\|A0A068V5X4_COFCA	7E-11	Coffea canephora DH200=94 genomic scaffold, scaffold_112 {ECO:0000313\|EMBL:CDP15967.1}
TAIR10	AT3G06240.1	0.000002	F-box family protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000005	gene	23177481	23178671	+
GWHAAZE00000005	mRNA	23177481	23178671	+
GWHAAZE00000005	exon	23177481	23177679	+
GWHAAZE00000005	exon	23178199	23178671	+
GWHAAZE00000005	CDS	23177481	23177679	+
GWHAAZE00000005	CDS	23178199	23178671	+

Transcript Sequence
>GWHTAAZE018735 ATGGGAAATCGCAACAAAACGAAGAGAAGCAGAGGCATAATGCTTCCCTATATGCCTGAAGAAATCTTGACAGAGGTATTTGTAAGACTACCCATTGCGTCTCTTTTACGATTAAGGTGCGTTTGTAAATCCTTGTGTTCCCTAATTAGTAGCCCTAGCTTTACTACTGCACACATTGCTTACCAAAAATTGCAAGAAAAAAGGAAGGTGGGTTCTGTAGATTTGATGGTGGCATTTGATATGCTTAATGGGGTATTTGAAGAGATAATGTTGCCCGATATTGACTGCAAGAGGGAAAAGTGTGTTTCTATGGCTGCATTTGGTGGATCACTTTATTATTCTCATTGTAATGGTGTTGCACATGATAACTATGATTGTGATATATGGGTGTTGAAGTTCAGCAAAAACACGTTTACATGGACAAAACAATATACTATTAACCTCCCAAATATAAGAGGGCCACCACTCAGTTTCAGAAAGAATGGTGAAGTTGTACTATCAACGGATACTGGAGGTCATGTTTCTTATAACATTGAGGTAAAACGAGCTGAGGAATTTAAAGTTGCATGGTTCCCAAAATTTTCTGTAGATTCTTTCTTTGAGATTCTTGTTCTGCTTAGTGATGTAAATGGAGTTTTGGGGCCAAAATTTCTAGTGATGAAAAGAAAATGA

Network for GWHGAAZE018713

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00646.34	F-box	18	55	5.40E-09

Protein Sequence

Gene family

Gene family	subfamily
Ubiquitin Family	F-box

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0005515	molecular_function	protein binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.194
	SRR3591706	second leaf	0.074
	SRR3591707	mature leaf	0.090
	SRR3591708	Shoot apex	0.169
	SRR3591709	Stem	0.016
	SRR3591710	White floral bud	0.049
	SRR3591711	White flower	0.000
	SRR3591712	Green floral bud	0.352
	SRR3591713	Yellow flower	0.047
SRP173429	SRR8316895	Juvenile bud stage	0.108
	SRR8316896	Juvenile bud stage	0.280
	SRR8316897	Juvenile bud stage	0.152
	SRR8316894	Third green stage	0.044
	SRR8316900	Third green stage	0.412
	SRR8316901	Third green stage	0.444
	SRR8316898	Complete white stage	0.053
	SRR8316899	Complete white stage	0.259
	SRR8316903	Complete white stage	0.070
	SRR8316902	Silver flowering stage	0.000
	SRR8316904	Silver flowering stage	0.000
	SRR8316905	Silver flowering stage	0.051
	SRR8316906	Gold flowering stage	0.073
	SRR8316907	Gold flowering stage	0.000
	SRR8316908	Gold flowering stage	0.000
SRP132670	SRR6706286	Control	0.023
	SRR6706287	Light intensity 50%	0.040
	SRR6706288	Light intensity 20%	0.088
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.601
	CNS0095593	Slightly white alabastrum(diploid) 2	0.602
	CNS0095594	Slightly white alabastrum(diploid) 3	0.407
	CNS0095595	Whole white alabastrum(diploid) 2	0.119
	CNS0095596	Whole white alabastrum(diploid) 3	0.280
	CNS0095597	Whole white alabastrum(diploid) 4	0.115
	CNS0095598	Silvery flower (diploied) 1	0.266
	CNS0095599	Silvery flower (diploied) 2	0.096
	CNS0095600	Silvery flower (diploied) 3	0.106
	CNS0095601	Golden flower (diploid) 1	0.495
	CNS0095602	Golden flower (diploid) 2	0.260
	CNS0095603	Golden flower (diploid) 3	0.237
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.326
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.439
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.602
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.110
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.105
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.634
	CNS0095610	Silvery flower (tetraploid) 1	0.165
	CNS0095611	Silvery flower (tetraploid) 2	0.014
	CNS0095612	Silvery flower (tetraploid) 3	0.212
	CNS0095613	Golden flower (tetraploid) 1	0.076
	CNS0095614	Golden flower (tetraploid) 2	0.054
	CNS0095615	Golden flower (tetraploid) 3	0.018
CRA001975	CRR073297	Stem 1	0.069
	CRR073298	Stem 2	0.225
	CRR073299	Stem 3	0.000
	CRR073300	Leaf 1	0.180
	CRR073301	Leaf 2	0.243
	CRR073302	Leaf 3	0.045
	CRR073303	Juvenile bud 1	0.000
	CRR073304	Juvenile bud 2	0.028
	CRR073305	Juvenile bud 3	0.041
	CRR073306	Third green 1	0.000
	CRR073307	Third green 2	0.000
	CRR073308	Third green 3	0.000
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.000
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	0.042
	CRR073316	Gold flowering 2	0.000
	CRR073317	Gold flowering 3	0.031
	CRR073318	Tawny withering 1	0.055
	CRR073319	Tawny withering 2	0.144
	CRR073320	Tawny withering 3	0.062