Gene detail

Detail information of GWHGAAZE018786

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	AHJ79202.1	7.1983E-103	NAC domain protein NAC61 [Gossypium hirsutum]
Swissprot	tr\|Q8H4S4\|NAC10_ORYSJ	2E-47	NAC transcription factor ONAC010
trEMBL	tr\|W6JF10\|W6JF10_GOSHI	3E-103	NAC domain protein NAC61 {ECO:0000313\|EMBL:AHJ79202.1}
TAIR10	AT5G64530.1	1E-55	xylem NAC domain 1

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000005	gene	24333800	24335335	+
GWHAAZE00000005	mRNA	24333800	24335335	+
GWHAAZE00000005	exon	24333800	24333965	+
GWHAAZE00000005	exon	24334407	24334687	+
GWHAAZE00000005	exon	24335198	24335335	+
GWHAAZE00000005	CDS	24333800	24333965	+
GWHAAZE00000005	CDS	24334407	24334687	+
GWHAAZE00000005	CDS	24335198	24335335	+

Transcript Sequence
>GWHTAAZE018808 ATGGGTGATCATAGGAATGTGAACCTGCCACCGGGTTTTAGGTTCTATCCGACGGATGAAGAGCTGGTGGTTCATTTCCTTCAACGCAAGGCCTCCCTCTTGCCTTGCCATCCCGATGTCATTCCCGATCTTGATCTCTATCCCTATGATCCATGGGACCTCCATGGTAAAGCAATGGCGGAAGGTAACAAGTGGTACTTTTATAGCAGGAGGACACAGAACCGGATCACGGAGAATGGGTATTGGAAGGCAATGGGGGGAGATGAAGCAATAATGAGTAGTGGTGGTAGTAAAAGAGTTGGTATGAAGAGATATTATATGTTTTACTTTGGTGAATCTCCTGAAGGTGTCAAGACAAATTGGATCATGGAAGAGTTTAGGCTTTCAGATGCGGCTTCTACTAGTAGTACTAGATCTTCCAAGAGAAGAGGCGCACATTCCAAGATTGACTATAGCAAATGGGTGGTGTGTCGAGTATATGAGCACAACTGTGACGACGGCAATGACAGTGGGGCAGAGCTTTCGTGCTTGGATGAAGTTTTCTTATCGCTAGACGATCTCGAAGAAATTAGTTTACCGAATTAG

Network for GWHGAAZE018786

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF02365.16	NAM	10	128	7.50E-31

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	NAC

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0006355	biological_process	regulation of transcription, DNA-templated
GO:0003677	molecular_function	DNA binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	4.524
	SRR3591706	second leaf	8.280
	SRR3591707	mature leaf	2.073
	SRR3591708	Shoot apex	8.086
	SRR3591709	Stem	1.953
	SRR3591710	White floral bud	19.071
	SRR3591711	White flower	44.553
	SRR3591712	Green floral bud	2.402
	SRR3591713	Yellow flower	50.266
SRP173429	SRR8316895	Juvenile bud stage	1.702
	SRR8316896	Juvenile bud stage	1.542
	SRR8316897	Juvenile bud stage	1.502
	SRR8316894	Third green stage	0.790
	SRR8316900	Third green stage	0.496
	SRR8316901	Third green stage	0.759
	SRR8316898	Complete white stage	3.667
	SRR8316899	Complete white stage	0.854
	SRR8316903	Complete white stage	6.213
	SRR8316902	Silver flowering stage	11.556
	SRR8316904	Silver flowering stage	21.638
	SRR8316905	Silver flowering stage	8.707
	SRR8316906	Gold flowering stage	14.714
	SRR8316907	Gold flowering stage	38.797
	SRR8316908	Gold flowering stage	35.006
SRP132670	SRR6706286	Control	1.071
	SRR6706287	Light intensity 50%	0.908
	SRR6706288	Light intensity 20%	0.849
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	1.471
	CNS0095593	Slightly white alabastrum(diploid) 2	0.581
	CNS0095594	Slightly white alabastrum(diploid) 3	1.987
	CNS0095595	Whole white alabastrum(diploid) 2	0.326
	CNS0095596	Whole white alabastrum(diploid) 3	1.226
	CNS0095597	Whole white alabastrum(diploid) 4	0.394
	CNS0095598	Silvery flower (diploied) 1	14.093
	CNS0095599	Silvery flower (diploied) 2	6.342
	CNS0095600	Silvery flower (diploied) 3	15.879
	CNS0095601	Golden flower (diploid) 1	3.497
	CNS0095602	Golden flower (diploid) 2	5.619
	CNS0095603	Golden flower (diploid) 3	6.500
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.841
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.233
	CNS0095606	Slightly white alabastrum(tetraploid) 3	1.784
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.082
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.040
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.298
	CNS0095610	Silvery flower (tetraploid) 1	57.347
	CNS0095611	Silvery flower (tetraploid) 2	36.488
	CNS0095612	Silvery flower (tetraploid) 3	51.847
	CNS0095613	Golden flower (tetraploid) 1	14.607
	CNS0095614	Golden flower (tetraploid) 2	23.799
	CNS0095615	Golden flower (tetraploid) 3	15.007
CRA001975	CRR073297	Stem 1	3.068
	CRR073298	Stem 2	1.595
	CRR073299	Stem 3	2.681
	CRR073300	Leaf 1	0.662
	CRR073301	Leaf 2	0.422
	CRR073302	Leaf 3	0.525
	CRR073303	Juvenile bud 1	0.107
	CRR073304	Juvenile bud 2	0.594
	CRR073305	Juvenile bud 3	0.157
	CRR073306	Third green 1	31.603
	CRR073307	Third green 2	51.915
	CRR073308	Third green 3	49.026
	CRR073309	Second white 1	20.244
	CRR073310	Second white 2	13.962
	CRR073311	Second white 3	5.637
	CRR073312	Silver flowering 1	3.451
	CRR073313	Silver flowering 2	4.107
	CRR073314	Silver flowering 3	2.557
	CRR073315	Gold flowering 1	0.077
	CRR073316	Gold flowering 2	0.900
	CRR073317	Gold flowering 3	1.261
	CRR073318	Tawny withering 1	2.773
	CRR073319	Tawny withering 2	0.362
	CRR073320	Tawny withering 3	3.906