Gene detail

Detail information of GWHGAAZE018922

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_009362381.1	3.6348E-115	PREDICTED: putative 12-oxophytodienoate reductase 11 [Pyrus x bretschneideri]
Swissprot	tr\|B9FSC8\|OPR11_ORYSJ	2E-113	Putative 12-oxophytodienoate reductase 11
trEMBL	tr\|M5XGD8\|M5XGD8_PRUPE	7E-114	Uncharacterized protein {ECO:0000313\|EMBL:EMJ24531.1}
TAIR10	AT1G09400.1	8E-91	FMN-linked oxidoreductases superfamily protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000005	gene	27073195	27075013	+
GWHAAZE00000005	mRNA	27073195	27075013	+
GWHAAZE00000005	exon	27073195	27073401	+
GWHAAZE00000005	exon	27073974	27074050	+
GWHAAZE00000005	exon	27074490	27075013	+
GWHAAZE00000005	five_prime_UTR	27073195	27073204	+
GWHAAZE00000005	CDS	27073205	27073401	+
GWHAAZE00000005	CDS	27073974	27074050	+
GWHAAZE00000005	CDS	27074490	27075013	+

Transcript Sequence
>GWHTAAZE018944 GTGTCCAAATATGCCTGGAATATGGAAAAAAAAACAAGTGAAAACATGGAAACCAATAGTGAATGCAGTTCATGAGAAAGGTGGCATTTTCTTCTGCCAAATTTGGCATACTGGTCGTGTACCTGATTTTTCTCATGAGCAATTCATTTTTGGGTGGGCTATTGGTCAAGATAATACATATGCCCCTCAATTTTTATTTTTCTCAAAGGAGCAACTGACGACAGATGAAATCGCTTGCATTGTGAACGATTTTACGGTTGCTTCACGTAATGCCATCGAAGCTGGCTTTGATGGAGTTGAGATACTCGGTGCAAATGGATACTTGATTGATCAGTTCATGAAAGATAAAGCAAACAATAGGACAGACCAATATGGGGGGAGATTAGAGAATCGTTGTCGAATTGCACTAGAAGTGGTAGAAGCAGTGGCGAATGAGATTGGAGCTGATAAAGTCGGAATAAAACTATCTCCATTTGATGAACACAATGGCTCCAGCGATGCAGATCCAGAAACTCTAGGCCTTTACATGGCAAACGCGCTTAGCAAGCTCGAAATTCTTTATATTCATATGACCGAGCCAAGGATGATTAGAAATGGAGACGGGTGCTATGAAGCACAACAGCGCCTTTATCCAATGAGGGCAGTGTTTAAAGGTACATTTATTGCGTCGGGTGGTTATAACAAATCTAATGGTGATAAAGCTATAGTTGAAAATTACGCAGATTTGATTTCATTTGGACGCTTGTTCTTGGCTAACCCTGATTTGCCTAAGCGTTTTGAACTCAATGCACCTCTTAACAAGCACGAA

Network for GWHGAAZE018922

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00724.21	Oxidored_FMN	2	262	9.70E-64

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K05894	OPR	Metabolic pathways	map01100
		Biosynthesis of secondary metabolites	map01110
		alpha-Linolenic acid metabolism	map00592

Gene Ontology

GO term	Ontology	Name
GO:0055114	biological_process	oxidation-reduction process
GO:0010181	molecular_function	FMN binding
GO:0016491	molecular_function	oxidoreductase activity
GO:0003824	molecular_function	catalytic activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.000
	SRR3591706	second leaf	0.000
	SRR3591707	mature leaf	0.196
	SRR3591708	Shoot apex	0.131
	SRR3591709	Stem	0.000
	SRR3591710	White floral bud	6.615
	SRR3591711	White flower	3.494
	SRR3591712	Green floral bud	9.343
	SRR3591713	Yellow flower	4.148
SRP173429	SRR8316895	Juvenile bud stage	0.000
	SRR8316896	Juvenile bud stage	0.050
	SRR8316897	Juvenile bud stage	0.002
	SRR8316894	Third green stage	0.123
	SRR8316900	Third green stage	2.153
	SRR8316901	Third green stage	2.767
	SRR8316898	Complete white stage	0.000
	SRR8316899	Complete white stage	0.701
	SRR8316903	Complete white stage	0.552
	SRR8316902	Silver flowering stage	0.142
	SRR8316904	Silver flowering stage	0.159
	SRR8316905	Silver flowering stage	0.005
	SRR8316906	Gold flowering stage	0.100
	SRR8316907	Gold flowering stage	0.000
	SRR8316908	Gold flowering stage	0.000
SRP132670	SRR6706286	Control	1.236
	SRR6706287	Light intensity 50%	1.040
	SRR6706288	Light intensity 20%	0.988
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.609
	CNS0095593	Slightly white alabastrum(diploid) 2	0.801
	CNS0095594	Slightly white alabastrum(diploid) 3	0.291
	CNS0095595	Whole white alabastrum(diploid) 2	3.600
	CNS0095596	Whole white alabastrum(diploid) 3	4.582
	CNS0095597	Whole white alabastrum(diploid) 4	2.937
	CNS0095598	Silvery flower (diploied) 1	0.407
	CNS0095599	Silvery flower (diploied) 2	0.427
	CNS0095600	Silvery flower (diploied) 3	0.230
	CNS0095601	Golden flower (diploid) 1	0.405
	CNS0095602	Golden flower (diploid) 2	0.220
	CNS0095603	Golden flower (diploid) 3	0.005
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.812
	CNS0095605	Slightly white alabastrum(tetraploid) 2	1.008
	CNS0095606	Slightly white alabastrum(tetraploid) 3	1.462
	CNS0095607	Whole white alabastrum(tetraploid) 1	3.378
	CNS0095608	Whole white alabastrum(tetraploid) 2	6.035
	CNS0095609	Whole white alabastrum(tetraploid) 3	2.344
	CNS0095610	Silvery flower (tetraploid) 1	0.192
	CNS0095611	Silvery flower (tetraploid) 2	0.152
	CNS0095612	Silvery flower (tetraploid) 3	0.031
	CNS0095613	Golden flower (tetraploid) 1	0.122
	CNS0095614	Golden flower (tetraploid) 2	0.496
	CNS0095615	Golden flower (tetraploid) 3	0.166
CRA001975	CRR073297	Stem 1	0.044
	CRR073298	Stem 2	0.298
	CRR073299	Stem 3	0.131
	CRR073300	Leaf 1	2.992
	CRR073301	Leaf 2	1.862
	CRR073302	Leaf 3	1.488
	CRR073303	Juvenile bud 1	0.392
	CRR073304	Juvenile bud 2	1.350
	CRR073305	Juvenile bud 3	0.405
	CRR073306	Third green 1	0.216
	CRR073307	Third green 2	0.000
	CRR073308	Third green 3	0.554
	CRR073309	Second white 1	0.155
	CRR073310	Second white 2	0.000
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.034
	CRR073315	Gold flowering 1	0.000
	CRR073316	Gold flowering 2	0.108
	CRR073317	Gold flowering 3	0.000
	CRR073318	Tawny withering 1	0.298
	CRR073319	Tawny withering 2	0.366
	CRR073320	Tawny withering 3	1.024