Gene detail

Detail information of GWHGAAZE019003

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_007154103.1	2.30689E-94	hypothetical protein PHAVU_003G090700g [Phaseolus vulgaris]
Swissprot	tr\|Q40359\|ALFIN_MEDSA	8E-90	PHD finger protein Alfin1
trEMBL	tr\|A0A078E6K0\|A0A078E6K0_BRANA	2E-98	BnaA08g23940D protein {ECO:0000313\|EMBL:CDX96851.1}
TAIR10	AT1G14510.1	5E-57	alfin-like 7

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000005	gene	29098069	29101154	+
GWHAAZE00000005	mRNA	29098069	29101154	+
GWHAAZE00000005	exon	29098069	29098072	+
GWHAAZE00000005	exon	29098396	29098624	+
GWHAAZE00000005	exon	29099895	29100024	+
GWHAAZE00000005	exon	29100876	29101154	+
GWHAAZE00000005	CDS	29098069	29098072	+
GWHAAZE00000005	CDS	29098396	29098624	+
GWHAAZE00000005	CDS	29099895	29100024	+
GWHAAZE00000005	CDS	29100876	29101154	+

Transcript Sequence
>GWHTAAZE019025 ATGGAGAAAGAGAATTTGTGTCTTTATGGAATTCCAAATGAGACATGGGAAGTCAACCTGCCTGTTGAGGAGGTACCTCCGGAACTTCCTGAGCCAGCACTAGGAATAAACTTTGCTAGGGATGGGATGCAAGAGAAAGACTGGTTATCACTTGTTGCAGTCCACAGCGATACCTGGCTGCTTTCTGTTGCATTCTATTTTGGAGCGCGCTTCGGATTTGGTAGGAATGAAAGGAAGAGGCTATTTCAGATGATAAATGATCTCCCAACTGTATTTGAAGTTGTGACAGGAAAGGTTAATCCATCAAAGGACCAGCCTGCTACTAAGAAAAACGGAAACAAAAGCAAATCAAGTGGGAAGGCGTCTCGGTCATCAGAGCCCAAGGGAGCAAGAGCATTGCAGCCACCTACTGATCAAGAAGGCGAGACTGGTGAGGAGGAAGAAGGAGGGAAGAACAGGGAGCAGCCCTATGGAGCTTGTGGGGATAACGATGGTGAAGATCCCTTCTGGATTTGCTGCGATGTTTGTGAGAGGTGGTTCCACGGAAAATGTGTAAAGATAACACCTGCCAAAGCTGAGCATATCAAGCATTACAAGTGCCCTATTTGCACTAGCAACAAGAAGGCAAGACATCAGTTCTAA

Network for GWHGAAZE019003

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF12165.9	Alfin	2	97	6.60E-50
PF00628.30	PHD	159	205	2.50E-09

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	Alfin-like

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0006355	biological_process	regulation of transcription, DNA-templated
GO:0042393	molecular_function	histone binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	34.016
	SRR3591706	second leaf	22.251
	SRR3591707	mature leaf	31.994
	SRR3591708	Shoot apex	28.187
	SRR3591709	Stem	17.860
	SRR3591710	White floral bud	29.489
	SRR3591711	White flower	26.843
	SRR3591712	Green floral bud	28.498
	SRR3591713	Yellow flower	31.934
SRP173429	SRR8316895	Juvenile bud stage	15.171
	SRR8316896	Juvenile bud stage	18.258
	SRR8316897	Juvenile bud stage	7.188
	SRR8316894	Third green stage	7.764
	SRR8316900	Third green stage	25.269
	SRR8316901	Third green stage	24.247
	SRR8316898	Complete white stage	9.310
	SRR8316899	Complete white stage	34.339
	SRR8316903	Complete white stage	14.527
	SRR8316902	Silver flowering stage	12.160
	SRR8316904	Silver flowering stage	11.047
	SRR8316905	Silver flowering stage	6.663
	SRR8316906	Gold flowering stage	22.134
	SRR8316907	Gold flowering stage	21.021
	SRR8316908	Gold flowering stage	16.027
SRP132670	SRR6706286	Control	22.278
	SRR6706287	Light intensity 50%	22.570
	SRR6706288	Light intensity 20%	20.661
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	20.591
	CNS0095593	Slightly white alabastrum(diploid) 2	18.074
	CNS0095594	Slightly white alabastrum(diploid) 3	19.701
	CNS0095595	Whole white alabastrum(diploid) 2	16.731
	CNS0095596	Whole white alabastrum(diploid) 3	15.946
	CNS0095597	Whole white alabastrum(diploid) 4	15.329
	CNS0095598	Silvery flower (diploied) 1	22.410
	CNS0095599	Silvery flower (diploied) 2	12.075
	CNS0095600	Silvery flower (diploied) 3	18.413
	CNS0095601	Golden flower (diploid) 1	16.169
	CNS0095602	Golden flower (diploid) 2	20.932
	CNS0095603	Golden flower (diploid) 3	19.740
	CNS0095604	Slightly white alabastrum(tetraploid) 1	15.440
	CNS0095605	Slightly white alabastrum(tetraploid) 2	14.361
	CNS0095606	Slightly white alabastrum(tetraploid) 3	27.534
	CNS0095607	Whole white alabastrum(tetraploid) 1	11.310
	CNS0095608	Whole white alabastrum(tetraploid) 2	8.456
	CNS0095609	Whole white alabastrum(tetraploid) 3	17.227
	CNS0095610	Silvery flower (tetraploid) 1	24.422
	CNS0095611	Silvery flower (tetraploid) 2	22.387
	CNS0095612	Silvery flower (tetraploid) 3	20.821
	CNS0095613	Golden flower (tetraploid) 1	18.966
	CNS0095614	Golden flower (tetraploid) 2	20.456
	CNS0095615	Golden flower (tetraploid) 3	21.473
CRA001975	CRR073297	Stem 1	21.699
	CRR073298	Stem 2	20.421
	CRR073299	Stem 3	25.728
	CRR073300	Leaf 1	22.169
	CRR073301	Leaf 2	23.698
	CRR073302	Leaf 3	26.550
	CRR073303	Juvenile bud 1	21.169
	CRR073304	Juvenile bud 2	21.164
	CRR073305	Juvenile bud 3	28.151
	CRR073306	Third green 1	14.286
	CRR073307	Third green 2	12.423
	CRR073308	Third green 3	13.834
	CRR073309	Second white 1	19.431
	CRR073310	Second white 2	18.430
	CRR073311	Second white 3	17.112
	CRR073312	Silver flowering 1	16.731
	CRR073313	Silver flowering 2	24.322
	CRR073314	Silver flowering 3	17.906
	CRR073315	Gold flowering 1	31.183
	CRR073316	Gold flowering 2	37.346
	CRR073317	Gold flowering 3	29.486
	CRR073318	Tawny withering 1	23.164
	CRR073319	Tawny withering 2	27.259
	CRR073320	Tawny withering 3	23.426