Gene detail

Detail information of GWHGAAZE019017

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	AFS28674.1	7.59355E-98	putative 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase, partial [Olea europaea]
Swissprot	tr\|P69834\|ISPD_ARATH	2E-91	2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase, chloroplastic (Precursor)
trEMBL	tr\|J9XJ77\|J9XJ77_OLEEU	3E-98	Putative 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase {ECO:0000313\|EMBL:AFS28674.1} (Fragment)
TAIR10	AT2G02500.1	6E-74	Nucleotide-diphospho-sugar transferases superfamily protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000005	gene	29251082	29254161	-
GWHAAZE00000005	mRNA	29251082	29254161	-
GWHAAZE00000005	exon	29251082	29251150	-
GWHAAZE00000005	exon	29251458	29251548	-
GWHAAZE00000005	exon	29251837	29251850	-
GWHAAZE00000005	exon	29252440	29252508	-
GWHAAZE00000005	exon	29252978	29253055	-
GWHAAZE00000005	exon	29253507	29253589	-
GWHAAZE00000005	exon	29253733	29253812	-
GWHAAZE00000005	exon	29254112	29254161	-
GWHAAZE00000005	CDS	29254112	29254161	-
GWHAAZE00000005	CDS	29253733	29253812	-
GWHAAZE00000005	CDS	29253507	29253589	-
GWHAAZE00000005	CDS	29252978	29253055	-
GWHAAZE00000005	CDS	29252440	29252508	-
GWHAAZE00000005	CDS	29251837	29251850	-
GWHAAZE00000005	CDS	29251458	29251548	-
GWHAAZE00000005	CDS	29251082	29251150	-

Transcript Sequence
>GWHTAAZE019039 ATGCCGAAGCAGTATCTTCCGCTCTTAGGCCAACCAATTGCTTTGTATAGCTTCTACACTTTCTCACTCATGCCTGAAGTGAAGGAAATTATTGTCGTTTGTGATCCTTCTTATGAGGACATCTTTGAAGACACTAGAGGGAAGATCCAAGTGGACCTGAAATTTGCATTGCCTGGAAAGGAGAGACAAGATTCAGTATACAGTGGACTTCAGGCAGTTGATCTAAAGTCTGAACTTGTATGCATCCATGATTCTGCAAGACCTCTGGTATCATCTGAAGATGTAAAAAAGGTTATGAAGGATGGTTTATCAGTTGGAGCAGCTGTACTTGGTGTCCCTGCTAAAGCTACAATCAAAGAGGTTATCAAGCCTGAAGGTGGTCTTGAAGTCACTGATGATGTGTCCATTGTGGAGCACCTTAAGCATCCTGTTTACATCACCGAAGGGTCTTACACAAACATCAAGGTTACAACCCCTGATGATCTACTACTTGCAGAAAGGATATTGAATACTGCCTCTGCAGTGGCAGCTTAG

Network for GWHGAAZE019017

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF01128.20	IspD	2	121	3.40E-20
PF01128.20	IspD	127	170	9.70E-11

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K00991	ispD	Metabolic pathways	map01100
		Biosynthesis of secondary metabolites	map01110
		Terpenoid backbone biosynthesis	map00900

Gene Ontology

GO term	Ontology	Name
GO:0008299	biological_process	isoprenoid biosynthetic process
GO:0070567	molecular_function	cytidylyltransferase activity
GO:0003824	molecular_function	catalytic activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	8.284
	SRR3591706	second leaf	32.423
	SRR3591707	mature leaf	19.252
	SRR3591708	Shoot apex	17.534
	SRR3591709	Stem	6.878
	SRR3591710	White floral bud	15.934
	SRR3591711	White flower	14.234
	SRR3591712	Green floral bud	18.341
	SRR3591713	Yellow flower	21.167
SRP173429	SRR8316895	Juvenile bud stage	18.529
	SRR8316896	Juvenile bud stage	14.838
	SRR8316897	Juvenile bud stage	3.256
	SRR8316894	Third green stage	8.486
	SRR8316900	Third green stage	28.985
	SRR8316901	Third green stage	24.489
	SRR8316898	Complete white stage	12.069
	SRR8316899	Complete white stage	29.351
	SRR8316903	Complete white stage	17.859
	SRR8316902	Silver flowering stage	11.632
	SRR8316904	Silver flowering stage	16.469
	SRR8316905	Silver flowering stage	7.954
	SRR8316906	Gold flowering stage	29.590
	SRR8316907	Gold flowering stage	26.617
	SRR8316908	Gold flowering stage	16.781
SRP132670	SRR6706286	Control	3.517
	SRR6706287	Light intensity 50%	4.770
	SRR6706288	Light intensity 20%	5.169
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	16.181
	CNS0095593	Slightly white alabastrum(diploid) 2	16.197
	CNS0095594	Slightly white alabastrum(diploid) 3	17.975
	CNS0095595	Whole white alabastrum(diploid) 2	21.619
	CNS0095596	Whole white alabastrum(diploid) 3	15.163
	CNS0095597	Whole white alabastrum(diploid) 4	19.206
	CNS0095598	Silvery flower (diploied) 1	18.229
	CNS0095599	Silvery flower (diploied) 2	13.628
	CNS0095600	Silvery flower (diploied) 3	28.405
	CNS0095601	Golden flower (diploid) 1	17.403
	CNS0095602	Golden flower (diploid) 2	23.224
	CNS0095603	Golden flower (diploid) 3	22.187
	CNS0095604	Slightly white alabastrum(tetraploid) 1	6.331
	CNS0095605	Slightly white alabastrum(tetraploid) 2	7.555
	CNS0095606	Slightly white alabastrum(tetraploid) 3	15.918
	CNS0095607	Whole white alabastrum(tetraploid) 1	4.857
	CNS0095608	Whole white alabastrum(tetraploid) 2	3.611
	CNS0095609	Whole white alabastrum(tetraploid) 3	12.511
	CNS0095610	Silvery flower (tetraploid) 1	15.951
	CNS0095611	Silvery flower (tetraploid) 2	14.883
	CNS0095612	Silvery flower (tetraploid) 3	13.933
	CNS0095613	Golden flower (tetraploid) 1	12.544
	CNS0095614	Golden flower (tetraploid) 2	11.342
	CNS0095615	Golden flower (tetraploid) 3	11.409
CRA001975	CRR073297	Stem 1	19.040
	CRR073298	Stem 2	16.251
	CRR073299	Stem 3	13.023
	CRR073300	Leaf 1	21.031
	CRR073301	Leaf 2	15.665
	CRR073302	Leaf 3	22.123
	CRR073303	Juvenile bud 1	18.568
	CRR073304	Juvenile bud 2	17.219
	CRR073305	Juvenile bud 3	13.777
	CRR073306	Third green 1	9.170
	CRR073307	Third green 2	6.776
	CRR073308	Third green 3	9.068
	CRR073309	Second white 1	14.717
	CRR073310	Second white 2	15.587
	CRR073311	Second white 3	16.636
	CRR073312	Silver flowering 1	22.010
	CRR073313	Silver flowering 2	14.610
	CRR073314	Silver flowering 3	17.734
	CRR073315	Gold flowering 1	26.617
	CRR073316	Gold flowering 2	35.159
	CRR073317	Gold flowering 3	20.299
	CRR073318	Tawny withering 1	18.477
	CRR073319	Tawny withering 2	12.767
	CRR073320	Tawny withering 3	22.442