Gene detail

Detail information of GWHGAAZE019043

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_003528722.1	6.42594E-84	PREDICTED: protein FEZ-like [Glycine max]
Swissprot	tr\|Q9ZVH0\|FEZ_ARATH	1E-52	Protein FEZ
trEMBL	tr\|I1KNQ2\|I1KNQ2_SOYBN	2E-84	Uncharacterized protein {ECO:0000313\|EnsemblPlants:GLYMA07G40140.1}
TAIR10	AT2G02450.2	8E-63	NAC domain containing protein 35

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000005	gene	30684966	30686360	-
GWHAAZE00000005	mRNA	30684966	30686360	-
GWHAAZE00000005	exon	30686138	30686360	-
GWHAAZE00000005	exon	30684966	30685165	-
GWHAAZE00000005	CDS	30686138	30686360	-
GWHAAZE00000005	CDS	30684966	30685165	-

Transcript Sequence
>GWHTAAZE019065 ATGAATAATCAAGATCATCATCATCATGAAGAACAAGAAGGGATCAACAACAAATTAGACGATCAGCACGAACACGACTTGGTGATGCCAGGGTTTAGGTTCCACCCTACCGAGGAAGAGCTTGTGGAGTTCTACCTTCGCCGTAAGGTAGAGGGAAAGAGATTCAATGTTGAACTCATCACTTTTCTTGATCTTTACCGCTATGACCCTTGGGAACTTCCTGCTTTGGCGGCAATTGGAGAGAAGGAATGGTACTTCTATGTGCCTAGAGATAGAAAGTATCGAAACGGAGACCGGCCTAATCGTGTAACAACTTCAGGATATTGGAAGGCTACCGGAGCTGATAGAATGATAAGAACTGAGAATTTCCGGTCAATTGGTCTAAAAAAGACGCTTGTTTTCTACTCCGGGAAAGCCCCGAAA

Network for GWHGAAZE019043

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF02365.16	NAM	30	137	3.70E-29

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	NAC

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0006355	biological_process	regulation of transcription, DNA-templated
GO:0003677	molecular_function	DNA binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.439
	SRR3591706	second leaf	12.159
	SRR3591707	mature leaf	19.205
	SRR3591708	Shoot apex	4.688
	SRR3591709	Stem	0.260
	SRR3591710	White floral bud	0.932
	SRR3591711	White flower	1.477
	SRR3591712	Green floral bud	0.160
	SRR3591713	Yellow flower	0.314
SRP173429	SRR8316895	Juvenile bud stage	0.335
	SRR8316896	Juvenile bud stage	1.058
	SRR8316897	Juvenile bud stage	0.127
	SRR8316894	Third green stage	0.404
	SRR8316900	Third green stage	0.701
	SRR8316901	Third green stage	0.539
	SRR8316898	Complete white stage	0.000
	SRR8316899	Complete white stage	0.277
	SRR8316903	Complete white stage	0.456
	SRR8316902	Silver flowering stage	0.087
	SRR8316904	Silver flowering stage	0.000
	SRR8316905	Silver flowering stage	0.000
	SRR8316906	Gold flowering stage	0.372
	SRR8316907	Gold flowering stage	0.413
	SRR8316908	Gold flowering stage	0.066
SRP132670	SRR6706286	Control	0.276
	SRR6706287	Light intensity 50%	0.298
	SRR6706288	Light intensity 20%	0.622
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.107
	CNS0095593	Slightly white alabastrum(diploid) 2	0.485
	CNS0095594	Slightly white alabastrum(diploid) 3	0.246
	CNS0095595	Whole white alabastrum(diploid) 2	0.033
	CNS0095596	Whole white alabastrum(diploid) 3	0.000
	CNS0095597	Whole white alabastrum(diploid) 4	0.519
	CNS0095598	Silvery flower (diploied) 1	0.162
	CNS0095599	Silvery flower (diploied) 2	0.070
	CNS0095600	Silvery flower (diploied) 3	0.067
	CNS0095601	Golden flower (diploid) 1	0.156
	CNS0095602	Golden flower (diploid) 2	0.333
	CNS0095603	Golden flower (diploid) 3	0.395
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.000
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.045
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.265
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.000
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.094
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.370
	CNS0095610	Silvery flower (tetraploid) 1	0.000
	CNS0095611	Silvery flower (tetraploid) 2	0.339
	CNS0095612	Silvery flower (tetraploid) 3	0.218
	CNS0095613	Golden flower (tetraploid) 1	0.000
	CNS0095614	Golden flower (tetraploid) 2	0.226
	CNS0095615	Golden flower (tetraploid) 3	0.164
CRA001975	CRR073297	Stem 1	3.056
	CRR073298	Stem 2	1.480
	CRR073299	Stem 3	0.906
	CRR073300	Leaf 1	1.167
	CRR073301	Leaf 2	1.654
	CRR073302	Leaf 3	1.104
	CRR073303	Juvenile bud 1	0.340
	CRR073304	Juvenile bud 2	0.256
	CRR073305	Juvenile bud 3	0.246
	CRR073306	Third green 1	0.069
	CRR073307	Third green 2	0.093
	CRR073308	Third green 3	0.225
	CRR073309	Second white 1	0.260
	CRR073310	Second white 2	1.038
	CRR073311	Second white 3	0.604
	CRR073312	Silver flowering 1	0.247
	CRR073313	Silver flowering 2	1.207
	CRR073314	Silver flowering 3	0.113
	CRR073315	Gold flowering 1	11.081
	CRR073316	Gold flowering 2	14.012
	CRR073317	Gold flowering 3	13.044
	CRR073318	Tawny withering 1	2.420
	CRR073319	Tawny withering 2	1.204
	CRR073320	Tawny withering 3	0.425