Gene detail

Detail information of GWHGAAZE019182

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	AFY99050.1	9.17018E-30	ribosomal protein 10, partial [Clermontia fauriei]
Swissprot	tr\|Q9M5M7\|RL10_EUPES	9E-31	60S ribosomal protein L10
trEMBL	tr\|F6GU72\|F6GU72_VITVI	4E-36	Putative uncharacterized protein {ECO:0000313\|EMBL:CCB43388.1}
TAIR10	AT1G66580.1	2E-21	senescence associated gene 24

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000005	gene	33413034	33413477	-
GWHAAZE00000005	mRNA	33413034	33413477	-
GWHAAZE00000005	exon	33413034	33413477	-
GWHAAZE00000005	CDS	33413034	33413477	-

Transcript Sequence
>GWHTAAZE019204 ATGACTAGGTTTGCAGGCAAGGATGCTTTCCACTTGAGGGTTAGGGTTCACCTTTTCCATGTATTGCGTATCAACAAGATGTCTTGTGCTGGGGCTGATAGGCTCCAAATCGGCCTGAGGGGTGCTTTCAGTAAGCCCCAGGACGTTTGTGCTTGTGTTAGCATCGGTCAGGTTCTGCTCTCTGTCCGTTCAAAGACTCGAATAGTGGTCATGGTCAAGAGGCTCTTCTCTGTGCTAAGCTCAAGTTCCCTGGCCAACAGAAGATCATTGTCAGGAGGAAGTGGGGATTCACCAAGTGTAGCCGTAATGACTATTTCATGTGGAAATCTGAAGGCCGAATTCTTCCTGATGGTGTCAATGCCAAGCTTCTCGGATGCCATGGACCTCTTGCGAGGCGTCAACCTGGACAAGCATTTACAGATGTTGCCCAAGACATTTTGTTGA

Network for GWHGAAZE019182

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
--	--	--	--	--

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K02866	RP-L10e, RPL10	Ribosome	map03010

Gene Ontology

GO term	Ontology	Name
GO:0006412	biological_process	translation
GO:0005840	cellular_component	ribosome
GO:0003735	molecular_function	structural constituent of ribosome

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	6.288
	SRR3591706	second leaf	4.221
	SRR3591707	mature leaf	2.889
	SRR3591708	Shoot apex	7.823
	SRR3591709	Stem	5.962
	SRR3591710	White floral bud	8.087
	SRR3591711	White flower	7.088
	SRR3591712	Green floral bud	4.603
	SRR3591713	Yellow flower	4.161
SRP173429	SRR8316895	Juvenile bud stage	6.981
	SRR8316896	Juvenile bud stage	10.968
	SRR8316897	Juvenile bud stage	5.961
	SRR8316894	Third green stage	2.628
	SRR8316900	Third green stage	8.438
	SRR8316901	Third green stage	9.536
	SRR8316898	Complete white stage	1.135
	SRR8316899	Complete white stage	9.481
	SRR8316903	Complete white stage	4.394
	SRR8316902	Silver flowering stage	2.552
	SRR8316904	Silver flowering stage	2.878
	SRR8316905	Silver flowering stage	1.491
	SRR8316906	Gold flowering stage	4.369
	SRR8316907	Gold flowering stage	4.468
	SRR8316908	Gold flowering stage	3.901
SRP132670	SRR6706286	Control	4.222
	SRR6706287	Light intensity 50%	4.457
	SRR6706288	Light intensity 20%	4.261
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	8.618
	CNS0095593	Slightly white alabastrum(diploid) 2	11.526
	CNS0095594	Slightly white alabastrum(diploid) 3	10.416
	CNS0095595	Whole white alabastrum(diploid) 2	6.420
	CNS0095596	Whole white alabastrum(diploid) 3	4.415
	CNS0095597	Whole white alabastrum(diploid) 4	5.723
	CNS0095598	Silvery flower (diploied) 1	13.509
	CNS0095599	Silvery flower (diploied) 2	14.634
	CNS0095600	Silvery flower (diploied) 3	9.142
	CNS0095601	Golden flower (diploid) 1	11.982
	CNS0095602	Golden flower (diploid) 2	8.114
	CNS0095603	Golden flower (diploid) 3	5.854
	CNS0095604	Slightly white alabastrum(tetraploid) 1	6.781
	CNS0095605	Slightly white alabastrum(tetraploid) 2	6.462
	CNS0095606	Slightly white alabastrum(tetraploid) 3	10.256
	CNS0095607	Whole white alabastrum(tetraploid) 1	6.807
	CNS0095608	Whole white alabastrum(tetraploid) 2	5.434
	CNS0095609	Whole white alabastrum(tetraploid) 3	4.850
	CNS0095610	Silvery flower (tetraploid) 1	5.044
	CNS0095611	Silvery flower (tetraploid) 2	5.445
	CNS0095612	Silvery flower (tetraploid) 3	7.423
	CNS0095613	Golden flower (tetraploid) 1	4.311
	CNS0095614	Golden flower (tetraploid) 2	5.473
	CNS0095615	Golden flower (tetraploid) 3	3.605
CRA001975	CRR073297	Stem 1	7.819
	CRR073298	Stem 2	4.745
	CRR073299	Stem 3	3.854
	CRR073300	Leaf 1	5.790
	CRR073301	Leaf 2	10.218
	CRR073302	Leaf 3	3.964
	CRR073303	Juvenile bud 1	4.322
	CRR073304	Juvenile bud 2	2.409
	CRR073305	Juvenile bud 3	3.831
	CRR073306	Third green 1	0.095
	CRR073307	Third green 2	0.916
	CRR073308	Third green 3	0.849
	CRR073309	Second white 1	0.340
	CRR073310	Second white 2	1.318
	CRR073311	Second white 3	1.876
	CRR073312	Silver flowering 1	0.938
	CRR073313	Silver flowering 2	1.534
	CRR073314	Silver flowering 3	0.717
	CRR073315	Gold flowering 1	5.256
	CRR073316	Gold flowering 2	5.646
	CRR073317	Gold flowering 3	1.024
	CRR073318	Tawny withering 1	3.883
	CRR073319	Tawny withering 2	7.825
	CRR073320	Tawny withering 3	5.311