Gene detail

Detail information of GWHGAAZE019403

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	CBI38888.3	1.6158E-133	unnamed protein product [Vitis vinifera]
Swissprot	tr\|O04887\|PME2_CITSI	7E-125	Pectinesterase 2 (Precursor)
trEMBL	tr\|F6I390\|F6I390_VITVI	4E-132	Pectinesterase {ECO:0000256\|RuleBase:RU000589}
TAIR10	AT2G45220.1	2E-96	Plant invertase/pectin methylesterase inhibitor superfamily

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000005	gene	41164576	41165262	-
GWHAAZE00000005	mRNA	41164576	41165262	-
GWHAAZE00000005	exon	41164576	41165262	-
GWHAAZE00000005	CDS	41164576	41165262	-

Transcript Sequence
>GWHTAAZE019425 GCTGTCGTGGGAGACGGATTCATAGCCCGTGGCATAACATTCCGCAACACTGCGGGCCCACAGAACCACCAGGCCGTGGCCCTCCGGTCCGGCTCCGACCTCTCGGTATTTTACCAATGTTCCTTCGAAGGCTATCAAGACACCCTCTACGTTCACTCAGACCGCCAATTTTATAAAAACTGTGATATTTACGGTACAGTCGACTTCATTTTTGGCAACGCTGCCGTAGTTTTCCAAAATTGCAATATTTACCCCCGCAACCCGCCCAACAAAACCAACACCATCACAGCCCAGGGCCGAACCGACGCAAATCAGAACACAGGTATTTCGATTCACAACTGTCGGGTCACCCCAGCCTCGGATCTCAGATCGAATCAAGGGTCCGTTAGGACTTATTTGGGTCGGCCCTGGAAGCAGTATTCGAGGGTGGTGTTTATGCAGACTAATATGGATAGTTTCATTGACCCGGCAGGTTGGTTGCCATGGAGTGGGAATTTTGCATTAAGTACTTTGTATTATGGGGAGTATATGAATACTGGTCCGGGTTCAGCTACAGGTAGAAGGGTGAAGTGGGCGGTACCGGGTTATAACGAAAAGGGCGGAGGCGGGAGGTTTACAGTTGGGAGTTTTATTGCAGGGGGGTCTTGGTTGCCGGCTACCAATGTGCCATTTACTGCAGGGCTTTGA

Network for GWHGAAZE019403

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF01095.20	Pectinesterase	1	213	9.70E-105

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K01051	E3.1.1.11	Metabolic pathways	map01100
		Pentose and glucuronate interconversions	map00040
		Two-component system	map02020

Gene Ontology

GO term	Ontology	Name
GO:0042545	biological_process	cell wall modification
GO:0030599	molecular_function	pectinesterase activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.000
	SRR3591706	second leaf	0.000
	SRR3591707	mature leaf	0.000
	SRR3591708	Shoot apex	0.070
	SRR3591709	Stem	0.000
	SRR3591710	White floral bud	0.147
	SRR3591711	White flower	4.490
	SRR3591712	Green floral bud	0.019
	SRR3591713	Yellow flower	331.731
SRP173429	SRR8316895	Juvenile bud stage	0.000
	SRR8316896	Juvenile bud stage	0.027
	SRR8316897	Juvenile bud stage	0.000
	SRR8316894	Third green stage	0.000
	SRR8316900	Third green stage	0.000
	SRR8316901	Third green stage	0.000
	SRR8316898	Complete white stage	0.040
	SRR8316899	Complete white stage	0.027
	SRR8316903	Complete white stage	0.075
	SRR8316902	Silver flowering stage	0.000
	SRR8316904	Silver flowering stage	0.330
	SRR8316905	Silver flowering stage	0.080
	SRR8316906	Gold flowering stage	10.419
	SRR8316907	Gold flowering stage	23.181
	SRR8316908	Gold flowering stage	21.506
SRP132670	SRR6706286	Control	0.037
	SRR6706287	Light intensity 50%	0.023
	SRR6706288	Light intensity 20%	0.039
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.000
	CNS0095593	Slightly white alabastrum(diploid) 2	0.056
	CNS0095594	Slightly white alabastrum(diploid) 3	0.026
	CNS0095595	Whole white alabastrum(diploid) 2	0.071
	CNS0095596	Whole white alabastrum(diploid) 3	0.260
	CNS0095597	Whole white alabastrum(diploid) 4	0.047
	CNS0095598	Silvery flower (diploied) 1	0.811
	CNS0095599	Silvery flower (diploied) 2	0.100
	CNS0095600	Silvery flower (diploied) 3	0.698
	CNS0095601	Golden flower (diploid) 1	2.622
	CNS0095602	Golden flower (diploid) 2	90.396
	CNS0095603	Golden flower (diploid) 3	89.293
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.000
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.050
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.000
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.000
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.000
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.000
	CNS0095610	Silvery flower (tetraploid) 1	1.211
	CNS0095611	Silvery flower (tetraploid) 2	2.979
	CNS0095612	Silvery flower (tetraploid) 3	1.998
	CNS0095613	Golden flower (tetraploid) 1	24.892
	CNS0095614	Golden flower (tetraploid) 2	9.946
	CNS0095615	Golden flower (tetraploid) 3	20.888
CRA001975	CRR073297	Stem 1	0.163
	CRR073298	Stem 2	0.092
	CRR073299	Stem 3	0.157
	CRR073300	Leaf 1	0.047
	CRR073301	Leaf 2	0.126
	CRR073302	Leaf 3	0.061
	CRR073303	Juvenile bud 1	0.084
	CRR073304	Juvenile bud 2	0.278
	CRR073305	Juvenile bud 3	0.065
	CRR073306	Third green 1	0.168
	CRR073307	Third green 2	0.000
	CRR073308	Third green 3	0.587
	CRR073309	Second white 1	8.657
	CRR073310	Second white 2	15.659
	CRR073311	Second white 3	21.402
	CRR073312	Silver flowering 1	396.221
	CRR073313	Silver flowering 2	582.988
	CRR073314	Silver flowering 3	652.614
	CRR073315	Gold flowering 1	0.022
	CRR073316	Gold flowering 2	0.176
	CRR073317	Gold flowering 3	0.165
	CRR073318	Tawny withering 1	0.000
	CRR073319	Tawny withering 2	0.524
	CRR073320	Tawny withering 3	0.081