Gene detail

Detail information of GWHGAAZE019452

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	CDP19528.1	2.46097E-47	unnamed protein product [Coffea canephora]
Swissprot	tr\|Q94F49\|H2A5_ARATH	5E-49	Probable histone H2A.5
trEMBL	tr\|A0A068VIM7\|A0A068VIM7_COFCA	9E-48	Histone H2A {ECO:0000256\|RuleBase:RU003556}
TAIR10	AT5G27670.1	2E-32	histone H2A 7

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000005	gene	43633646	43635685	+
GWHAAZE00000005	mRNA	43633646	43635685	+
GWHAAZE00000005	exon	43633646	43633777	+
GWHAAZE00000005	exon	43635464	43635685	+
GWHAAZE00000005	CDS	43633646	43633777	+
GWHAAZE00000005	CDS	43635464	43635685	+

Transcript Sequence
>GWHTAAZE019474 ATGGAGGAGTCAGTTACGAAGGGCGCCGGAGGAAGGAGAGGAGGAGAGAGGAAGAAGGCGGTGACGAAGTCCGTCAAGGCTGGTCTTCAGTTTCCGGTGGGACGGATTCGCTCGGTATTTGAAGAAAGGCCGGTATTGGAATTGGCTGGAAACGCGGCAATGGACAACAAGAAGAACAGAATAAACCCTAGACATGTGCAATTGGCGATACGAAACGACGACGAATTGGGGAAGTTGTTGCAGGGGGTTACCATTGCAAGCGGAGGTGTTCTTCCAAATATAAACCCTATTTTGTTGCCGAAGAACTCTTCAACTAATGATGCTGAGAAAAATTCGGCAACCAAGGCGATTTAG

Network for GWHGAAZE019452

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF16211.6	Histone_H2A_C	74	104	1.30E-16

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K11251	H2A	Necroptosis	map04217

Gene Ontology

GO term	Ontology	Name
GO:0000786	cellular_component	nucleosome
GO:0005634	cellular_component	nucleus
GO:0003677	molecular_function	DNA binding
GO:0046982	molecular_function	protein heterodimerization activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.000
	SRR3591706	second leaf	0.000
	SRR3591707	mature leaf	0.000
	SRR3591708	Shoot apex	0.000
	SRR3591709	Stem	0.000
	SRR3591710	White floral bud	7.927
	SRR3591711	White flower	0.372
	SRR3591712	Green floral bud	15.180
	SRR3591713	Yellow flower	0.482
SRP173429	SRR8316895	Juvenile bud stage	16.337
	SRR8316896	Juvenile bud stage	34.178
	SRR8316897	Juvenile bud stage	13.053
	SRR8316894	Third green stage	7.724
	SRR8316900	Third green stage	17.163
	SRR8316901	Third green stage	22.918
	SRR8316898	Complete white stage	0.000
	SRR8316899	Complete white stage	0.228
	SRR8316903	Complete white stage	0.000
	SRR8316902	Silver flowering stage	0.248
	SRR8316904	Silver flowering stage	0.180
	SRR8316905	Silver flowering stage	0.000
	SRR8316906	Gold flowering stage	0.000
	SRR8316907	Gold flowering stage	0.000
	SRR8316908	Gold flowering stage	0.000
SRP132670	SRR6706286	Control	7.565
	SRR6706287	Light intensity 50%	9.250
	SRR6706288	Light intensity 20%	7.388
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	46.223
	CNS0095593	Slightly white alabastrum(diploid) 2	25.873
	CNS0095594	Slightly white alabastrum(diploid) 3	61.905
	CNS0095595	Whole white alabastrum(diploid) 2	34.181
	CNS0095596	Whole white alabastrum(diploid) 3	42.901
	CNS0095597	Whole white alabastrum(diploid) 4	37.741
	CNS0095598	Silvery flower (diploied) 1	0.448
	CNS0095599	Silvery flower (diploied) 2	1.116
	CNS0095600	Silvery flower (diploied) 3	0.291
	CNS0095601	Golden flower (diploid) 1	1.864
	CNS0095602	Golden flower (diploid) 2	0.088
	CNS0095603	Golden flower (diploid) 3	0.168
	CNS0095604	Slightly white alabastrum(tetraploid) 1	38.532
	CNS0095605	Slightly white alabastrum(tetraploid) 2	39.048
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.000
	CNS0095607	Whole white alabastrum(tetraploid) 1	51.257
	CNS0095608	Whole white alabastrum(tetraploid) 2	50.884
	CNS0095609	Whole white alabastrum(tetraploid) 3	29.142
	CNS0095610	Silvery flower (tetraploid) 1	0.307
	CNS0095611	Silvery flower (tetraploid) 2	0.854
	CNS0095612	Silvery flower (tetraploid) 3	2.585
	CNS0095613	Golden flower (tetraploid) 1	0.981
	CNS0095614	Golden flower (tetraploid) 2	0.441
	CNS0095615	Golden flower (tetraploid) 3	0.729
CRA001975	CRR073297	Stem 1	18.125
	CRR073298	Stem 2	16.613
	CRR073299	Stem 3	15.000
	CRR073300	Leaf 1	13.484
	CRR073301	Leaf 2	13.042
	CRR073302	Leaf 3	11.744
	CRR073303	Juvenile bud 1	5.514
	CRR073304	Juvenile bud 2	9.695
	CRR073305	Juvenile bud 3	0.096
	CRR073306	Third green 1	0.654
	CRR073307	Third green 2	2.432
	CRR073308	Third green 3	1.160
	CRR073309	Second white 1	0.099
	CRR073310	Second white 2	0.000
	CRR073311	Second white 3	0.133
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.945
	CRR073314	Silver flowering 3	0.915
	CRR073315	Gold flowering 1	3.094
	CRR073316	Gold flowering 2	0.193
	CRR073317	Gold flowering 3	1.433
	CRR073318	Tawny withering 1	2.167
	CRR073319	Tawny withering 2	1.533
	CRR073320	Tawny withering 3	1.593