Gene detail

Detail information of GWHGAAZE019538

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_007020057.1	2.05652E-74	HSP20-like chaperones superfamily protein [Theobroma cacao]
Swissprot	tr\|Q38806\|HSP22_ARATH	1E-69	22.0 kDa heat shock protein (Precursor)
trEMBL	tr\|A0A061FKT5\|A0A061FKT5_THECC	8E-75	HSP20-like chaperones superfamily protein {ECO:0000313\|EMBL:EOY17282.1}
TAIR10	AT4G10250.1	1E-48	HSP20-like chaperones superfamily protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000005	gene	50029019	50029504	+
GWHAAZE00000005	mRNA	50029019	50029504	+
GWHAAZE00000005	exon	50029019	50029504	+
GWHAAZE00000005	CDS	50029019	50029504	+

Transcript Sequence
>GWHTAAZE019560 ATGGGATCTGAATTACTCGGATCGGATTTATTTTCTGACCCGTTTAAAATACTCGAACACGTCCCTCTTGCACTTGAGAGGGACGAGAATCTCGCTCTGTCTCCCGCCAGAGTGGACTGGCGGGAGACAGCTTCCGGACACCAGATAACGATAGAGGTTCCGGGAATGAAGAAGGAGGAGTTGAAGATCGAGGTGGAGGAGAACAAAGTACTACGCGTTAGCGGAGAGAGAAAGAGGGAGGAGAAGGAGAGTAAAGGTGACCACTGGCACTGCTCGGAGCGGTCCTACGGTAAGTTCTGGCGGCAGTTCCGGTTGCCGGAGAATGTCGATCTGGACTCGATTAAAGCGAAGCTAGAGGATGGCGTGCTTGTTATTTCTATCAATAAGTTGTCGCCGGATCGGATTAAGGGGCCGAAGGTGGTGAGTATTGGCGCCGGAGAGGAAAAAGGGTCGTTGCCGGCGAGCGAGGCCAAACAGGAACTTTAA

Network for GWHGAAZE019538

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00011.22	HSP20	39	143	6.70E-30

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K13993	HSP20	Protein processing in endoplasmic reticulum	map04141

Gene Ontology

GO term	Ontology	Name

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.000
	SRR3591706	second leaf	0.000
	SRR3591707	mature leaf	0.000
	SRR3591708	Shoot apex	0.000
	SRR3591709	Stem	0.158
	SRR3591710	White floral bud	0.000
	SRR3591711	White flower	0.000
	SRR3591712	Green floral bud	0.335
	SRR3591713	Yellow flower	0.000
SRP173429	SRR8316895	Juvenile bud stage	0.170
	SRR8316896	Juvenile bud stage	4.665
	SRR8316897	Juvenile bud stage	1.221
	SRR8316894	Third green stage	0.000
	SRR8316900	Third green stage	0.000
	SRR8316901	Third green stage	0.000
	SRR8316898	Complete white stage	0.000
	SRR8316899	Complete white stage	0.000
	SRR8316903	Complete white stage	0.000
	SRR8316902	Silver flowering stage	0.000
	SRR8316904	Silver flowering stage	0.000
	SRR8316905	Silver flowering stage	0.000
	SRR8316906	Gold flowering stage	0.000
	SRR8316907	Gold flowering stage	0.210
	SRR8316908	Gold flowering stage	0.000
SRP132670	SRR6706286	Control	0.142
	SRR6706287	Light intensity 50%	0.159
	SRR6706288	Light intensity 20%	0.042
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.000
	CNS0095593	Slightly white alabastrum(diploid) 2	0.139
	CNS0095594	Slightly white alabastrum(diploid) 3	0.111
	CNS0095595	Whole white alabastrum(diploid) 2	0.000
	CNS0095596	Whole white alabastrum(diploid) 3	0.000
	CNS0095597	Whole white alabastrum(diploid) 4	0.133
	CNS0095598	Silvery flower (diploied) 1	0.000
	CNS0095599	Silvery flower (diploied) 2	2.457
	CNS0095600	Silvery flower (diploied) 3	0.434
	CNS0095601	Golden flower (diploid) 1	13.522
	CNS0095602	Golden flower (diploid) 2	0.332
	CNS0095603	Golden flower (diploid) 3	0.375
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.000
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.092
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.000
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.000
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.000
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.186
	CNS0095610	Silvery flower (tetraploid) 1	0.000
	CNS0095611	Silvery flower (tetraploid) 2	0.000
	CNS0095612	Silvery flower (tetraploid) 3	0.000
	CNS0095613	Golden flower (tetraploid) 1	0.000
	CNS0095614	Golden flower (tetraploid) 2	0.370
	CNS0095615	Golden flower (tetraploid) 3	0.000
CRA001975	CRR073297	Stem 1	0.000
	CRR073298	Stem 2	0.000
	CRR073299	Stem 3	0.000
	CRR073300	Leaf 1	0.654
	CRR073301	Leaf 2	0.000
	CRR073302	Leaf 3	0.000
	CRR073303	Juvenile bud 1	0.176
	CRR073304	Juvenile bud 2	0.000
	CRR073305	Juvenile bud 3	0.445
	CRR073306	Third green 1	0.000
	CRR073307	Third green 2	0.000
	CRR073308	Third green 3	0.083
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.000
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	0.000
	CRR073316	Gold flowering 2	0.000
	CRR073317	Gold flowering 3	0.000
	CRR073318	Tawny withering 1	1.237
	CRR073319	Tawny withering 2	0.000
	CRR073320	Tawny withering 3	0.673