Gene detail

Detail information of GWHGAAZE019716

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_004296433.1	1.29217E-44	PREDICTED: auxin-responsive protein IAA33-like [Fragaria vesca subsp. vesca]
Swissprot	tr\|Q9FKM7\|IAA33_ARATH	4E-30	Auxin-responsive protein IAA33
trEMBL	tr\|I3S3X0\|I3S3X0_LOTJA	3E-41	Auxin-induced protein {ECO:0000256\|RuleBase:RU004549}
TAIR10	AT5G57420.1	2E-21	indole-3-acetic acid inducible 33

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000005	gene	59005297	59005722	-
GWHAAZE00000005	mRNA	59005297	59005722	-
GWHAAZE00000005	exon	59005297	59005722	-
GWHAAZE00000005	CDS	59005297	59005722	-

Transcript Sequence
>GWHTAAZE019738 ATGAACAGCATCGAATCTCAGAGACAAGATTCCTTAAAGAGGAGGTGGCAATTAGCCTCTAGATTCCTTGCTAAACCTACTAGTAACAACACTAACAACAATAATCCTCTGCAGCAGAGATTTTCAAGTGGGCGGCTGGGTGATGACGATGATGATCTGGTGTTGTCTAGGGTGGTGCCACCGCAGGTGACGGTGGTGCTGGAGGGCCGTTCGATCGGGCACCGCATCAGCCTTCATAAGCATGCAAGCTACCATAGCCTAGCCAAGGCTCTCAGGCAGATGTTTGTGGATGACGTGGGAGGGGGAGAGGGTGATCATCATCATCAAGTAGTACTGGATTTGTCAAATGCTGTGCCTGGTCACCTCATTGCTTATGAAGATATGGAGAATGATCTTCTCCTTGTTGGTGACCTTAATTGGAAGTAA

Network for GWHGAAZE019716

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF02309.17	AUX_IAA	59	141	1.70E-10

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	AUX/IAA

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0005515	molecular_function	protein binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	5.738
	SRR3591706	second leaf	0.561
	SRR3591707	mature leaf	0.547
	SRR3591708	Shoot apex	7.704
	SRR3591709	Stem	1.038
	SRR3591710	White floral bud	1.313
	SRR3591711	White flower	0.917
	SRR3591712	Green floral bud	4.095
	SRR3591713	Yellow flower	0.000
SRP173429	SRR8316895	Juvenile bud stage	1.752
	SRR8316896	Juvenile bud stage	1.087
	SRR8316897	Juvenile bud stage	0.308
	SRR8316894	Third green stage	0.164
	SRR8316900	Third green stage	0.185
	SRR8316901	Third green stage	0.266
	SRR8316898	Complete white stage	0.040
	SRR8316899	Complete white stage	1.221
	SRR8316903	Complete white stage	0.302
	SRR8316902	Silver flowering stage	0.038
	SRR8316904	Silver flowering stage	0.146
	SRR8316905	Silver flowering stage	0.040
	SRR8316906	Gold flowering stage	0.203
	SRR8316907	Gold flowering stage	0.000
	SRR8316908	Gold flowering stage	0.022
SRP132670	SRR6706286	Control	2.793
	SRR6706287	Light intensity 50%	2.108
	SRR6706288	Light intensity 20%	0.828
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.357
	CNS0095593	Slightly white alabastrum(diploid) 2	0.992
	CNS0095594	Slightly white alabastrum(diploid) 3	0.299
	CNS0095595	Whole white alabastrum(diploid) 2	1.030
	CNS0095596	Whole white alabastrum(diploid) 3	0.000
	CNS0095597	Whole white alabastrum(diploid) 4	1.002
	CNS0095598	Silvery flower (diploied) 1	1.658
	CNS0095599	Silvery flower (diploied) 2	0.770
	CNS0095600	Silvery flower (diploied) 3	0.503
	CNS0095601	Golden flower (diploid) 1	0.764
	CNS0095602	Golden flower (diploid) 2	0.687
	CNS0095603	Golden flower (diploid) 3	0.832
	CNS0095604	Slightly white alabastrum(tetraploid) 1	4.509
	CNS0095605	Slightly white alabastrum(tetraploid) 2	3.209
	CNS0095606	Slightly white alabastrum(tetraploid) 3	17.402
	CNS0095607	Whole white alabastrum(tetraploid) 1	5.472
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.267
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.260
	CNS0095610	Silvery flower (tetraploid) 1	0.052
	CNS0095611	Silvery flower (tetraploid) 2	0.356
	CNS0095612	Silvery flower (tetraploid) 3	0.738
	CNS0095613	Golden flower (tetraploid) 1	0.000
	CNS0095614	Golden flower (tetraploid) 2	0.000
	CNS0095615	Golden flower (tetraploid) 3	0.000
CRA001975	CRR073297	Stem 1	1.011
	CRR073298	Stem 2	2.011
	CRR073299	Stem 3	1.760
	CRR073300	Leaf 1	0.245
	CRR073301	Leaf 2	0.652
	CRR073302	Leaf 3	0.414
	CRR073303	Juvenile bud 1	0.043
	CRR073304	Juvenile bud 2	0.150
	CRR073305	Juvenile bud 3	0.278
	CRR073306	Third green 1	0.050
	CRR073307	Third green 2	0.000
	CRR073308	Third green 3	0.000
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.000
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	0.060
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	0.066
	CRR073316	Gold flowering 2	0.000
	CRR073317	Gold flowering 3	0.146
	CRR073318	Tawny withering 1	0.000
	CRR073319	Tawny withering 2	1.532
	CRR073320	Tawny withering 3	0.000