Gene detail

Detail information of GWHGAAZE019785

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	CAN68616.1	6.25584E-58	hypothetical protein VITISV_023390 [Vitis vinifera]
trEMBL	tr\|A5C471\|A5C471_VITVI	2E-58	Putative uncharacterized protein {ECO:0000313\|EMBL:CAN68616.1}
TAIR10	AT1G22660.1	7E-44	Polynucleotide adenylyltransferase family protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000005	gene	61864758	61870115	-
GWHAAZE00000005	mRNA	61864758	61870115	-
GWHAAZE00000005	exon	61869999	61870115	-
GWHAAZE00000005	exon	61866797	61866891	-
GWHAAZE00000005	exon	61866464	61866513	-
GWHAAZE00000005	exon	61865021	61865130	-
GWHAAZE00000005	exon	61864758	61864895	-
GWHAAZE00000005	CDS	61869999	61870115	-
GWHAAZE00000005	CDS	61866797	61866891	-
GWHAAZE00000005	CDS	61866464	61866513	-
GWHAAZE00000005	CDS	61865021	61865130	-
GWHAAZE00000005	CDS	61864758	61864895	-

Transcript Sequence
>GWHTAAZE019807 AATCCTGATCAATCAAAACACTTGGAAACAGCAAAGATGTGCATAGATGGTATAGAAGTTGATTTTGTCAACTTAAGATCTGAAGACTACAGTGAAAATAGCCGCATTCCTATGGTGGAAGTCTGGAACATACGACACTTTTTACTTTTTGTATTACAGAGATTTGGCACCGCAGAAGAAGATGCATATAGAAGGGATTTAACCATTAATAGCTTGTTCTACAATATTAATACAGGTTCAGTTGAAGATTTTTCTGGAAGAGGGGTGAGATTCGGATTTATACTAGATGAAGACCTAAAAATTGCAGCTTCTGACCATGATGTGAAAGCTGCTCTTGCTCGAAAAATTACGAGAGACCGTATTGGTCATGAAATAAATCTCATGATATCTGGCAAGTATCCTGATCAAGCTATGACCTACATTTGGGACGTGCAGATATTTTCAGTTATCTTCAGCATACCTCATCAGCTAGAGCTTCCAGCTTCTGAAGAGAGGTCATTTTACCTTTAA

Network for GWHGAAZE019785

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation
CFinderModule0040

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF01743.21	PolyA_pol	5	89	1.60E-12
PF12627.8	PolyA_pol_RNAbd	110	155	0.0001

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0006396	biological_process	RNA processing
GO:0003723	molecular_function	RNA binding
GO:0016779	molecular_function	nucleotidyltransferase activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.479
	SRR3591706	second leaf	0.077
	SRR3591707	mature leaf	0.000
	SRR3591708	Shoot apex	0.345
	SRR3591709	Stem	0.089
	SRR3591710	White floral bud	0.195
	SRR3591711	White flower	0.104
	SRR3591712	Green floral bud	0.131
	SRR3591713	Yellow flower	0.145
SRP173429	SRR8316895	Juvenile bud stage	2.637
	SRR8316896	Juvenile bud stage	4.049
	SRR8316897	Juvenile bud stage	0.054
	SRR8316894	Third green stage	1.587
	SRR8316900	Third green stage	4.391
	SRR8316901	Third green stage	3.099
	SRR8316898	Complete white stage	1.420
	SRR8316899	Complete white stage	5.804
	SRR8316903	Complete white stage	3.231
	SRR8316902	Silver flowering stage	1.374
	SRR8316904	Silver flowering stage	2.239
	SRR8316905	Silver flowering stage	1.103
	SRR8316906	Gold flowering stage	2.920
	SRR8316907	Gold flowering stage	3.186
	SRR8316908	Gold flowering stage	0.800
SRP132670	SRR6706286	Control	2.661
	SRR6706287	Light intensity 50%	2.805
	SRR6706288	Light intensity 20%	2.493
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	4.478
	CNS0095593	Slightly white alabastrum(diploid) 2	6.194
	CNS0095594	Slightly white alabastrum(diploid) 3	3.823
	CNS0095595	Whole white alabastrum(diploid) 2	3.279
	CNS0095596	Whole white alabastrum(diploid) 3	4.143
	CNS0095597	Whole white alabastrum(diploid) 4	3.888
	CNS0095598	Silvery flower (diploied) 1	3.009
	CNS0095599	Silvery flower (diploied) 2	5.128
	CNS0095600	Silvery flower (diploied) 3	3.221
	CNS0095601	Golden flower (diploid) 1	2.929
	CNS0095602	Golden flower (diploid) 2	2.486
	CNS0095603	Golden flower (diploid) 3	2.385
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.038
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.477
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.150
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.000
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.026
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.159
	CNS0095610	Silvery flower (tetraploid) 1	0.266
	CNS0095611	Silvery flower (tetraploid) 2	0.000
	CNS0095612	Silvery flower (tetraploid) 3	0.057
	CNS0095613	Golden flower (tetraploid) 1	0.000
	CNS0095614	Golden flower (tetraploid) 2	0.000
	CNS0095615	Golden flower (tetraploid) 3	0.394
CRA001975	CRR073297	Stem 1	2.647
	CRR073298	Stem 2	1.555
	CRR073299	Stem 3	1.158
	CRR073300	Leaf 1	2.181
	CRR073301	Leaf 2	1.658
	CRR073302	Leaf 3	1.603
	CRR073303	Juvenile bud 1	1.498
	CRR073304	Juvenile bud 2	1.452
	CRR073305	Juvenile bud 3	1.699
	CRR073306	Third green 1	0.622
	CRR073307	Third green 2	0.334
	CRR073308	Third green 3	0.248
	CRR073309	Second white 1	0.374
	CRR073310	Second white 2	1.261
	CRR073311	Second white 3	0.091
	CRR073312	Silver flowering 1	0.480
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	0.913
	CRR073316	Gold flowering 2	1.166
	CRR073317	Gold flowering 3	0.542
	CRR073318	Tawny withering 1	1.591
	CRR073319	Tawny withering 2	1.700
	CRR073320	Tawny withering 3	1.845