Gene detail

Detail information of GWHGAAZE019911

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_002272357.1	4.419E-105	PREDICTED: 60S ribosomal protein L19-2 [Vitis vinifera]
COG	YP_183936.1	5E-22	50S ribosomal protein L19e
Swissprot	tr\|Q9LUQ6\|RL192_ARATH	1E-94	60S ribosomal protein L19-2
trEMBL	tr\|F6HZ71\|F6HZ71_VITVI	2E-105	Ribosomal protein L19 {ECO:0000256\|RuleBase:RU000574}
TAIR10	AT4G02230.1	1E-65	Ribosomal protein L19e family protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000005	gene	67602175	67603258	-
GWHAAZE00000005	mRNA	67602175	67603258	-
GWHAAZE00000005	exon	67602175	67602243	-
GWHAAZE00000005	exon	67602383	67602696	-
GWHAAZE00000005	exon	67603027	67603258	-
GWHAAZE00000005	CDS	67603027	67603258	-
GWHAAZE00000005	CDS	67602383	67602696	-
GWHAAZE00000005	CDS	67602175	67602243	-

Transcript Sequence
>GWHTAAZE019933 ATGCCAATTCTTTTCATGCATCCTTTTGTGCTAAAATGTGCTACTATACATTTTCTTCTGTTTATATACTTTTTGAATTTCATGTATTTCTTTGGTTTGTTGATTGCAGGCCAGAACATCAGAAAGCTGGTCAAGGATGGGTTTATTATAAGGAAACCAACTAAGATTCACTCCCGGTCTAGGGCACGTCGAATGAAGGAAGCCAAGAGAAAGGGCCGTCATTCTGGATATGGTAAAAGGAAAGGTACAAGGGAAGCAAGGTTGCCCACAAAAATCCTATGGATGAGGAGGATGAGAGTCCTTAGGCGCTTACTCCGCAAATACAGGGAATCAAAGAAGATCGACAAGCACATGTACCATGACATGTACATGAAGGTGAAAGGTAATGTCTTTAAGAATAAGCGTGTACTGATGGAGAGCATTCACAAATCCAAGGCTGAGAAGGCTAGGGAGAAGACTTTGTCCGACCAGTTCGAGGCTAAGCGTGCAAAGAACAAGGCAAGCAGGGAAAGAAAGTTTGCCAGGAGAGAGGAACGTTTGGCCCAGGGACCCGTAGAGAGGGCACCACAACCACCACCAGCAGCTGCAGCTCCTCCAGCCCAATCAGCACAGTAA

Network for GWHGAAZE019911

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF01280.21	Ribosomal_L19e	37	144	4.20E-45

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K02885	RP-L19e, RPL19	Ribosome	map03010

Gene Ontology

GO term	Ontology	Name
GO:0006412	biological_process	translation
GO:0005840	cellular_component	ribosome
GO:0003735	molecular_function	structural constituent of ribosome

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	490.174
	SRR3591706	second leaf	213.988
	SRR3591707	mature leaf	213.446
	SRR3591708	Shoot apex	611.848
	SRR3591709	Stem	360.489
	SRR3591710	White floral bud	251.830
	SRR3591711	White flower	283.296
	SRR3591712	Green floral bud	394.068
	SRR3591713	Yellow flower	178.124
SRP173429	SRR8316895	Juvenile bud stage	223.714
	SRR8316896	Juvenile bud stage	296.375
	SRR8316897	Juvenile bud stage	162.773
	SRR8316894	Third green stage	134.236
	SRR8316900	Third green stage	422.901
	SRR8316901	Third green stage	410.170
	SRR8316898	Complete white stage	84.360
	SRR8316899	Complete white stage	403.885
	SRR8316903	Complete white stage	152.352
	SRR8316902	Silver flowering stage	111.529
	SRR8316904	Silver flowering stage	101.300
	SRR8316905	Silver flowering stage	60.452
	SRR8316906	Gold flowering stage	186.299
	SRR8316907	Gold flowering stage	197.244
	SRR8316908	Gold flowering stage	238.344
SRP132670	SRR6706286	Control	527.307
	SRR6706287	Light intensity 50%	505.053
	SRR6706288	Light intensity 20%	512.925
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	390.663
	CNS0095593	Slightly white alabastrum(diploid) 2	464.217
	CNS0095594	Slightly white alabastrum(diploid) 3	378.947
	CNS0095595	Whole white alabastrum(diploid) 2	363.835
	CNS0095596	Whole white alabastrum(diploid) 3	367.723
	CNS0095597	Whole white alabastrum(diploid) 4	295.123
	CNS0095598	Silvery flower (diploied) 1	315.534
	CNS0095599	Silvery flower (diploied) 2	278.438
	CNS0095600	Silvery flower (diploied) 3	202.256
	CNS0095601	Golden flower (diploid) 1	312.137
	CNS0095602	Golden flower (diploid) 2	232.717
	CNS0095603	Golden flower (diploid) 3	235.032
	CNS0095604	Slightly white alabastrum(tetraploid) 1	376.435
	CNS0095605	Slightly white alabastrum(tetraploid) 2	368.403
	CNS0095606	Slightly white alabastrum(tetraploid) 3	512.055
	CNS0095607	Whole white alabastrum(tetraploid) 1	234.586
	CNS0095608	Whole white alabastrum(tetraploid) 2	211.800
	CNS0095609	Whole white alabastrum(tetraploid) 3	373.431
	CNS0095610	Silvery flower (tetraploid) 1	228.735
	CNS0095611	Silvery flower (tetraploid) 2	210.846
	CNS0095612	Silvery flower (tetraploid) 3	133.242
	CNS0095613	Golden flower (tetraploid) 1	159.007
	CNS0095614	Golden flower (tetraploid) 2	197.337
	CNS0095615	Golden flower (tetraploid) 3	121.181
CRA001975	CRR073297	Stem 1	447.320
	CRR073298	Stem 2	459.166
	CRR073299	Stem 3	488.779
	CRR073300	Leaf 1	469.742
	CRR073301	Leaf 2	518.810
	CRR073302	Leaf 3	540.769
	CRR073303	Juvenile bud 1	461.754
	CRR073304	Juvenile bud 2	392.733
	CRR073305	Juvenile bud 3	423.305
	CRR073306	Third green 1	95.226
	CRR073307	Third green 2	97.425
	CRR073308	Third green 3	108.814
	CRR073309	Second white 1	85.163
	CRR073310	Second white 2	81.695
	CRR073311	Second white 3	60.970
	CRR073312	Silver flowering 1	57.641
	CRR073313	Silver flowering 2	64.887
	CRR073314	Silver flowering 3	65.631
	CRR073315	Gold flowering 1	210.388
	CRR073316	Gold flowering 2	243.222
	CRR073317	Gold flowering 3	222.888
	CRR073318	Tawny withering 1	486.370
	CRR073319	Tawny withering 2	421.938
	CRR073320	Tawny withering 3	454.092