Gene detail

Detail information of GWHGAAZE020038

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	CBI40130.3	3.50994E-26	unnamed protein product [Vitis vinifera]
Swissprot	tr\|Q8S8N6\|PLA2A_ARATH	6E-22	Phospholipase A2-alpha (Precursor)
trEMBL	tr\|D7UBL5\|D7UBL5_VITVI	1E-26	Putative uncharacterized protein {ECO:0000313\|EMBL:CBI40130.3}
TAIR10	AT2G06925.1	4E-18	Phospholipase A2 family protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000005	gene	74182295	74186228	+
GWHAAZE00000005	mRNA	74182295	74186228	+
GWHAAZE00000005	exon	74182295	74182421	+
GWHAAZE00000005	exon	74186053	74186228	+
GWHAAZE00000005	CDS	74182295	74182421	+
GWHAAZE00000005	CDS	74186053	74186228	+

Transcript Sequence
>GWHTAAZE020060 ATGGATGCAGTACCTCCAAAAGTCCTTTACAGTCATGAACAATGGAATCCAGATCACCCTCTCTCCAGTAGACTTATGAATCATCTCTTAGATTTCAATGAACAATTTGATTTCTCAGATACTAATGATGATTATTTAAGCCAAGAGTGCAGCCAGAATTTCGTGAACTGTCTTACAAGTTTTACGAAGGCAGGGGCAAAGACATTTAAAGGGAACACATGCCAAGCTGATGAAGTTATTAATGTTATCACTGCTGTTATGGAGGCTGCTTTGCTTGCTGGAAGATACCTTCATAAACCTTAA

Network for GWHGAAZE020038

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
--	--	--	--	--

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K01047	PLA2G, SPLA2	Metabolic pathways	map01100
		Biosynthesis of secondary metabolites	map01110
		Glycerophospholipid metabolism	map00564
		Ether lipid metabolism	map00565
		Arachidonic acid metabolism	map00590
		Linoleic acid metabolism	map00591
		alpha-Linolenic acid metabolism	map00592
		Ras signaling pathway	map04014
		Vascular smooth muscle contraction	map04270
		Pancreatic secretion	map04972
		Fat digestion and absorption	map04975

Gene Ontology

GO term	Ontology	Name
GO:0006644	biological_process	phospholipid metabolic process
GO:0050482	biological_process	arachidonic acid secretion
GO:0004623	molecular_function	phospholipase A2 activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	5.605
	SRR3591706	second leaf	20.989
	SRR3591707	mature leaf	13.111
	SRR3591708	Shoot apex	15.724
	SRR3591709	Stem	14.351
	SRR3591710	White floral bud	19.606
	SRR3591711	White flower	20.688
	SRR3591712	Green floral bud	7.404
	SRR3591713	Yellow flower	12.322
SRP173429	SRR8316895	Juvenile bud stage	0.942
	SRR8316896	Juvenile bud stage	0.647
	SRR8316897	Juvenile bud stage	2.385
	SRR8316894	Third green stage	0.502
	SRR8316900	Third green stage	0.484
	SRR8316901	Third green stage	1.709
	SRR8316898	Complete white stage	0.707
	SRR8316899	Complete white stage	4.052
	SRR8316903	Complete white stage	2.514
	SRR8316902	Silver flowering stage	1.616
	SRR8316904	Silver flowering stage	1.772
	SRR8316905	Silver flowering stage	1.533
	SRR8316906	Gold flowering stage	2.627
	SRR8316907	Gold flowering stage	2.306
	SRR8316908	Gold flowering stage	2.634
SRP132670	SRR6706286	Control	0.018
	SRR6706287	Light intensity 50%	0.025
	SRR6706288	Light intensity 20%	0.150
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	1.040
	CNS0095593	Slightly white alabastrum(diploid) 2	3.802
	CNS0095594	Slightly white alabastrum(diploid) 3	1.381
	CNS0095595	Whole white alabastrum(diploid) 2	1.624
	CNS0095596	Whole white alabastrum(diploid) 3	0.875
	CNS0095597	Whole white alabastrum(diploid) 4	2.754
	CNS0095598	Silvery flower (diploied) 1	0.863
	CNS0095599	Silvery flower (diploied) 2	4.963
	CNS0095600	Silvery flower (diploied) 3	1.424
	CNS0095601	Golden flower (diploid) 1	1.551
	CNS0095602	Golden flower (diploid) 2	2.010
	CNS0095603	Golden flower (diploid) 3	0.779
	CNS0095604	Slightly white alabastrum(tetraploid) 1	8.178
	CNS0095605	Slightly white alabastrum(tetraploid) 2	7.818
	CNS0095606	Slightly white alabastrum(tetraploid) 3	3.953
	CNS0095607	Whole white alabastrum(tetraploid) 1	3.917
	CNS0095608	Whole white alabastrum(tetraploid) 2	5.555
	CNS0095609	Whole white alabastrum(tetraploid) 3	6.773
	CNS0095610	Silvery flower (tetraploid) 1	6.360
	CNS0095611	Silvery flower (tetraploid) 2	4.343
	CNS0095612	Silvery flower (tetraploid) 3	5.216
	CNS0095613	Golden flower (tetraploid) 1	7.064
	CNS0095614	Golden flower (tetraploid) 2	7.463
	CNS0095615	Golden flower (tetraploid) 3	6.140
CRA001975	CRR073297	Stem 1	0.043
	CRR073298	Stem 2	0.716
	CRR073299	Stem 3	0.942
	CRR073300	Leaf 1	0.653
	CRR073301	Leaf 2	0.979
	CRR073302	Leaf 3	0.095
	CRR073303	Juvenile bud 1	0.036
	CRR073304	Juvenile bud 2	0.643
	CRR073305	Juvenile bud 3	0.169
	CRR073306	Third green 1	0.796
	CRR073307	Third green 2	0.966
	CRR073308	Third green 3	0.868
	CRR073309	Second white 1	2.732
	CRR073310	Second white 2	2.267
	CRR073311	Second white 3	0.354
	CRR073312	Silver flowering 1	3.736
	CRR073313	Silver flowering 2	0.411
	CRR073314	Silver flowering 3	0.228
	CRR073315	Gold flowering 1	0.614
	CRR073316	Gold flowering 2	0.000
	CRR073317	Gold flowering 3	0.209
	CRR073318	Tawny withering 1	1.038
	CRR073319	Tawny withering 2	0.483
	CRR073320	Tawny withering 3	1.517