Gene detail

Detail information of GWHGAAZE020116

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	EYU26566.1	1.14106E-92	hypothetical protein MIMGU_mgv1a021994mg [Erythranthe guttata]
COG	NP_442426.1	9E-31	cytochrome P450
Swissprot	tr\|I7C6E8\|C7A52_PANGI	1E-86	Beta-amyrin 28-oxidase
trEMBL	tr\|A0A022QF46\|A0A022QF46_ERYGU	4E-93	Uncharacterized protein {ECO:0000313\|EMBL:EYU26566.1}
TAIR10	AT5G36110.1	3E-57	cytochrome P450, family 716, subfamily A, polypeptide 1

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000005	gene	77094980	77095814	+
GWHAAZE00000005	mRNA	77094980	77095814	+
GWHAAZE00000005	exon	77094980	77095162	+
GWHAAZE00000005	exon	77095515	77095814	+
GWHAAZE00000005	CDS	77094980	77095162	+
GWHAAZE00000005	CDS	77095515	77095814	+

Transcript Sequence
>GWHTAAZE020138 ATGGAAATTGCAAAGTCAAAATCGCCTGGCGAATTGCTGAATTGGGAGGATCTTCAAAAGATGAAGTATTCATGGAATTTTACTTGTGAGGTGTTGCGAGTTGCAACCCCACTTCAAGGAGCTTTCAGAGAATCACTTAGCGATTTTGTGTACAATGGTTTCATAATTCCAAAGGGTTGGAAGCTACATTGGAGTTCAAATACAACACACAAAAGTCCTGAAATCTTCCCTCAACCGCAAAAATTTGATCCTACAAGATTCGAGGGAAAAGGGCCGGCTCCGTACACGTTCGTGCCTTTCGGAGGAGGACCTAGAATGTGCCCCGGAAAAGAGTTTGCGCGACTGGAATTACTAGTCTTCATACACCACCTTGTTAAAAGGTTCAAGTTTGAGCTAGAAATTCCCAATGAGAAGATCATTGTGAATCCGATGCCTATTCCCGTTAAGGGTCTTCCAATTCGTCTTCATCCTCACACTCTCTAA

Network for GWHGAAZE020116

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00067.23	p450	13	133	2.60E-34

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0055114	biological_process	oxidation-reduction process
GO:0005506	molecular_function	iron ion binding
GO:0016705	molecular_function	oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen
GO:0020037	molecular_function	heme binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.000
	SRR3591706	second leaf	0.000
	SRR3591707	mature leaf	0.165
	SRR3591708	Shoot apex	0.000
	SRR3591709	Stem	0.000
	SRR3591710	White floral bud	0.508
	SRR3591711	White flower	1.054
	SRR3591712	Green floral bud	0.322
	SRR3591713	Yellow flower	1.385
SRP173429	SRR8316895	Juvenile bud stage	0.000
	SRR8316896	Juvenile bud stage	0.524
	SRR8316897	Juvenile bud stage	0.200
	SRR8316894	Third green stage	0.113
	SRR8316900	Third green stage	0.162
	SRR8316901	Third green stage	2.722
	SRR8316898	Complete white stage	1.368
	SRR8316899	Complete white stage	0.444
	SRR8316903	Complete white stage	2.024
	SRR8316902	Silver flowering stage	0.453
	SRR8316904	Silver flowering stage	1.636
	SRR8316905	Silver flowering stage	1.052
	SRR8316906	Gold flowering stage	12.992
	SRR8316907	Gold flowering stage	1.977
	SRR8316908	Gold flowering stage	17.167
SRP132670	SRR6706286	Control	0.254
	SRR6706287	Light intensity 50%	0.064
	SRR6706288	Light intensity 20%	0.081
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.000
	CNS0095593	Slightly white alabastrum(diploid) 2	0.102
	CNS0095594	Slightly white alabastrum(diploid) 3	0.671
	CNS0095595	Whole white alabastrum(diploid) 2	0.000
	CNS0095596	Whole white alabastrum(diploid) 3	0.000
	CNS0095597	Whole white alabastrum(diploid) 4	0.000
	CNS0095598	Silvery flower (diploied) 1	0.000
	CNS0095599	Silvery flower (diploied) 2	0.000
	CNS0095600	Silvery flower (diploied) 3	0.265
	CNS0095601	Golden flower (diploid) 1	0.420
	CNS0095602	Golden flower (diploid) 2	0.604
	CNS0095603	Golden flower (diploid) 3	0.358
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.000
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.025
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.000
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.000
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.031
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.000
	CNS0095610	Silvery flower (tetraploid) 1	0.442
	CNS0095611	Silvery flower (tetraploid) 2	0.000
	CNS0095612	Silvery flower (tetraploid) 3	0.255
	CNS0095613	Golden flower (tetraploid) 1	0.072
	CNS0095614	Golden flower (tetraploid) 2	0.675
	CNS0095615	Golden flower (tetraploid) 3	0.000
CRA001975	CRR073297	Stem 1	0.000
	CRR073298	Stem 2	0.041
	CRR073299	Stem 3	0.000
	CRR073300	Leaf 1	0.000
	CRR073301	Leaf 2	0.000
	CRR073302	Leaf 3	0.000
	CRR073303	Juvenile bud 1	0.000
	CRR073304	Juvenile bud 2	0.000
	CRR073305	Juvenile bud 3	0.108
	CRR073306	Third green 1	0.000
	CRR073307	Third green 2	0.000
	CRR073308	Third green 3	0.998
	CRR073309	Second white 1	0.041
	CRR073310	Second white 2	0.261
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	0.047
	CRR073313	Silver flowering 2	0.506
	CRR073314	Silver flowering 3	0.592
	CRR073315	Gold flowering 1	0.000
	CRR073316	Gold flowering 2	0.000
	CRR073317	Gold flowering 3	2.163
	CRR073318	Tawny withering 1	1.674
	CRR073319	Tawny withering 2	5.129
	CRR073320	Tawny withering 3	0.050