Gene detail

Detail information of GWHGAAZE020136

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_006381174.1	9.6484E-48	hypothetical protein POPTR_0006s08050g [Populus trichocarpa]
Swissprot	tr\|Q9M088\|E135_ARATH	5E-45	Glucan endo-1,3-beta-glucosidase 5 (Precursor)
trEMBL	tr\|U5GC29\|U5GC29_POPTR	4E-48	Uncharacterized protein {ECO:0000313\|EMBL:ERP58972.1}
TAIR10	AT5G58090.1	2E-29	O-Glycosyl hydrolases family 17 protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000005	gene	77773183	77773596	-
GWHAAZE00000005	mRNA	77773183	77773596	-
GWHAAZE00000005	exon	77773183	77773596	-
GWHAAZE00000005	CDS	77773183	77773596	-

Transcript Sequence
>GWHTAAZE020158 ATGTTCTTCTTAGTAATGTTATTATTAGTTTCAGTGGTGAGTTCAGTGGGTGGGATTGGTGCCAACTGGGGGACACAAGCATCACACCCACTGCCGCCAGAGACAGTGATGAGGTTGCTGAGGGAAAATGGGATTCGAAAGGTGAAGCTATTTGATGCATATTATGGGGCACTCAAGGTCCTTAGTAAATCTGGGATTGAGGTTATGGTTGGGATTCCCAATGACTTGTTAGCAGCTATGGCTTCAAGTACGAAAGCTGCTGAGAAATGGGTTTCCAAGAATGTCTCTGCTCATGTCTCTTCCAATAGTGTCAACATTAGGTCTGTCACTCTCCTCTCCTCTGCCTTTCAAAATTTCTTTTGCTTTTGTTTTGATATTCTTGAATCATTGGTGTCTATTAGTATTGTAGTCTGA

Network for GWHGAAZE020136

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00332.19	Glyco_hydro_17	19	102	2.00E-12

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K19893	GN5_6	Metabolic pathways	map01100
K19893	GN5_6	Starch and sucrose metabolism	map00500

Gene Ontology

GO term	Ontology	Name
GO:0005975	biological_process	carbohydrate metabolic process
GO:0004553	molecular_function	hydrolase activity, hydrolyzing O-glycosyl compounds

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.270
	SRR3591706	second leaf	0.000
	SRR3591707	mature leaf	0.000
	SRR3591708	Shoot apex	0.000
	SRR3591709	Stem	0.000
	SRR3591710	White floral bud	0.000
	SRR3591711	White flower	0.000
	SRR3591712	Green floral bud	0.000
	SRR3591713	Yellow flower	0.000
SRP173429	SRR8316895	Juvenile bud stage	0.467
	SRR8316896	Juvenile bud stage	0.717
	SRR8316897	Juvenile bud stage	0.000
	SRR8316894	Third green stage	0.451
	SRR8316900	Third green stage	1.261
	SRR8316901	Third green stage	0.558
	SRR8316898	Complete white stage	0.323
	SRR8316899	Complete white stage	6.377
	SRR8316903	Complete white stage	0.594
	SRR8316902	Silver flowering stage	0.281
	SRR8316904	Silver flowering stage	0.640
	SRR8316905	Silver flowering stage	0.228
	SRR8316906	Gold flowering stage	0.269
	SRR8316907	Gold flowering stage	0.070
	SRR8316908	Gold flowering stage	0.000
SRP132670	SRR6706286	Control	1.194
	SRR6706287	Light intensity 50%	1.120
	SRR6706288	Light intensity 20%	0.945
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	4.660
	CNS0095593	Slightly white alabastrum(diploid) 2	6.263
	CNS0095594	Slightly white alabastrum(diploid) 3	2.487
	CNS0095595	Whole white alabastrum(diploid) 2	6.354
	CNS0095596	Whole white alabastrum(diploid) 3	3.264
	CNS0095597	Whole white alabastrum(diploid) 4	4.054
	CNS0095598	Silvery flower (diploied) 1	4.005
	CNS0095599	Silvery flower (diploied) 2	3.731
	CNS0095600	Silvery flower (diploied) 3	1.548
	CNS0095601	Golden flower (diploid) 1	0.404
	CNS0095602	Golden flower (diploid) 2	0.238
	CNS0095603	Golden flower (diploid) 3	0.549
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.145
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.000
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.000
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.000
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.000
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.000
	CNS0095610	Silvery flower (tetraploid) 1	0.000
	CNS0095611	Silvery flower (tetraploid) 2	0.000
	CNS0095612	Silvery flower (tetraploid) 3	0.000
	CNS0095613	Golden flower (tetraploid) 1	0.000
	CNS0095614	Golden flower (tetraploid) 2	0.000
	CNS0095615	Golden flower (tetraploid) 3	0.000
CRA001975	CRR073297	Stem 1	1.319
	CRR073298	Stem 2	0.093
	CRR073299	Stem 3	0.904
	CRR073300	Leaf 1	0.587
	CRR073301	Leaf 2	1.290
	CRR073302	Leaf 3	1.211
	CRR073303	Juvenile bud 1	1.771
	CRR073304	Juvenile bud 2	0.518
	CRR073305	Juvenile bud 3	1.656
	CRR073306	Third green 1	0.000
	CRR073307	Third green 2	0.734
	CRR073308	Third green 3	0.277
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.000
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	4.336
	CRR073316	Gold flowering 2	2.307
	CRR073317	Gold flowering 3	1.610
	CRR073318	Tawny withering 1	2.997
	CRR073319	Tawny withering 2	8.179
	CRR073320	Tawny withering 3	1.416