Gene detail

Detail information of GWHGAAZE020189

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_010316846.1	1.01091E-16	PREDICTED: dihydroorotase, mitochondrial isoform X3 [Solanum lycopersicum]
COG	YP_003526221.1	2E-12	dihydroorotase, homodimeric type
Swissprot	tr\|O04904\|PYRC_ARATH	9E-16	Dihydroorotase, mitochondrial (Precursor)
trEMBL	tr\|M1CRG6\|M1CRG6_SOLTU	5E-17	Uncharacterized protein {ECO:0000313\|EnsemblPlants:PGSC0003DMT400073069}
TAIR10	AT4G22930.1	2E-13	pyrimidin 4

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000005	gene	79678434	79680646	-
GWHAAZE00000005	mRNA	79678434	79680646	-
GWHAAZE00000005	exon	79678434	79678578	-
GWHAAZE00000005	exon	79680507	79680539	-
GWHAAZE00000005	exon	79680633	79680646	-
GWHAAZE00000005	CDS	79680633	79680646	-
GWHAAZE00000005	CDS	79680507	79680539	-
GWHAAZE00000005	CDS	79678434	79678578	-

Transcript Sequence
>GWHTAAZE020211 ATGAACCAATTCAGGACAGGCAATTGTGTCAGCTGTGACAAGCGGAAGAGGGTGGCGCTGGACAAGCTAGAGGCATTCACAAGCTTCAACGGACCCGATTTTTATGGGTTTCAAAGAGATAGATCAAAACTCAAATTGACGAAGAGTCCATGGAAAGTACCAGAATCATTTCCATACAATCTGGTCATATAA

Network for GWHGAAZE020189

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
--	--	--	--	--

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K01465	URA4, pyrC	Metabolic pathways	map01100
K01465	URA4, pyrC	Pyrimidine metabolism	map00240

Gene Ontology

GO term	Ontology	Name

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	3.652
	SRR3591706	second leaf	5.980
	SRR3591707	mature leaf	2.773
	SRR3591708	Shoot apex	4.963
	SRR3591709	Stem	4.910
	SRR3591710	White floral bud	4.434
	SRR3591711	White flower	5.731
	SRR3591712	Green floral bud	4.041
	SRR3591713	Yellow flower	5.601
SRP173429	SRR8316895	Juvenile bud stage	3.409
	SRR8316896	Juvenile bud stage	2.013
	SRR8316897	Juvenile bud stage	2.019
	SRR8316894	Third green stage	1.308
	SRR8316900	Third green stage	2.196
	SRR8316901	Third green stage	3.996
	SRR8316898	Complete white stage	2.229
	SRR8316899	Complete white stage	2.744
	SRR8316903	Complete white stage	4.004
	SRR8316902	Silver flowering stage	3.036
	SRR8316904	Silver flowering stage	4.640
	SRR8316905	Silver flowering stage	1.485
	SRR8316906	Gold flowering stage	4.370
	SRR8316907	Gold flowering stage	3.756
	SRR8316908	Gold flowering stage	2.922
SRP132670	SRR6706286	Control	1.007
	SRR6706287	Light intensity 50%	1.400
	SRR6706288	Light intensity 20%	1.676
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	9.105
	CNS0095593	Slightly white alabastrum(diploid) 2	6.808
	CNS0095594	Slightly white alabastrum(diploid) 3	6.038
	CNS0095595	Whole white alabastrum(diploid) 2	4.616
	CNS0095596	Whole white alabastrum(diploid) 3	4.452
	CNS0095597	Whole white alabastrum(diploid) 4	4.663
	CNS0095598	Silvery flower (diploied) 1	6.858
	CNS0095599	Silvery flower (diploied) 2	4.802
	CNS0095600	Silvery flower (diploied) 3	5.444
	CNS0095601	Golden flower (diploid) 1	2.656
	CNS0095602	Golden flower (diploid) 2	3.766
	CNS0095603	Golden flower (diploid) 3	4.049
	CNS0095604	Slightly white alabastrum(tetraploid) 1	7.094
	CNS0095605	Slightly white alabastrum(tetraploid) 2	5.700
	CNS0095606	Slightly white alabastrum(tetraploid) 3	9.182
	CNS0095607	Whole white alabastrum(tetraploid) 1	5.034
	CNS0095608	Whole white alabastrum(tetraploid) 2	5.465
	CNS0095609	Whole white alabastrum(tetraploid) 3	4.484
	CNS0095610	Silvery flower (tetraploid) 1	6.181
	CNS0095611	Silvery flower (tetraploid) 2	4.806
	CNS0095612	Silvery flower (tetraploid) 3	5.787
	CNS0095613	Golden flower (tetraploid) 1	6.140
	CNS0095614	Golden flower (tetraploid) 2	4.406
	CNS0095615	Golden flower (tetraploid) 3	4.205
CRA001975	CRR073297	Stem 1	2.607
	CRR073298	Stem 2	3.371
	CRR073299	Stem 3	0.938
	CRR073300	Leaf 1	2.015
	CRR073301	Leaf 2	0.854
	CRR073302	Leaf 3	1.223
	CRR073303	Juvenile bud 1	0.590
	CRR073304	Juvenile bud 2	0.052
	CRR073305	Juvenile bud 3	0.863
	CRR073306	Third green 1	0.127
	CRR073307	Third green 2	0.461
	CRR073308	Third green 3	0.000
	CRR073309	Second white 1	0.581
	CRR073310	Second white 2	0.052
	CRR073311	Second white 3	0.163
	CRR073312	Silver flowering 1	0.385
	CRR073313	Silver flowering 2	1.524
	CRR073314	Silver flowering 3	0.112
	CRR073315	Gold flowering 1	1.129
	CRR073316	Gold flowering 2	2.008
	CRR073317	Gold flowering 3	0.145
	CRR073318	Tawny withering 1	1.531
	CRR073319	Tawny withering 2	1.668
	CRR073320	Tawny withering 3	1.501